Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRDM4 cdna clone

PRDM4 cDNA Clone

Gene Names
PRDM4; PFM1
Synonyms
PRDM4; PRDM4 cDNA Clone; PRDM4 cdna clone
Ordering
For Research Use Only!
Sequence
atgcatcacaggatgaatgaaatgaacctgagtccagtggggatggagcagctgacttcatcctctgtgagcaatgccttgccagtctcaggaagtcacctgggattggctgcctcacccactcacagtgccatccctgccccaggcctcccagtggcaattccaaacctgggtccctccctgagctctctgccttctgctctgtctttaatgctaccaatgggtattggggatcgaggggtgatgtgtgggttacctgaaagaaactacaccctacctccaccaccttaccctcacctggagagcagttatttcagaaccattctacctggcattttatcttatttagctgacagaccacctccacagtacatccaccctaactctataaatgttgatggtaatacagcattatctatcaccaataacccttcagcactagatccctatcagtccaatggaaatgttggattagaaccaggcattgtttcaatagactctcgctctgtgaacacacatggtgcccaaagtcttcatcccagtgatggccatgaggtggccttggacacagcaatcactatggagaacgtttctagggttaccagcccaatttcgacagatggaatggcagaggagcttacgatggacggtgttgcaggcgagcattcccaaatcccaaatggctccagaagtcatgaacctctgtctgtggattctgtgagcaacaaccttgcagcagacgctgtaggacatggtggtgtgatacccatgcatgggaatggcctggagctccctgtggtcatggagacagaccacattgcaagtcgggtcaatggcatgtctgacagtgccctcagtgactccattcacactgtggccatgagcaccaactctgtaagcgtggcactctctacctcacacaaccttgcctccctagaatctgtttccctccatgaagttggcctcagcctagaacctgtggctgtctcctccatcacccaggaggttgctatggggacaggtcatgtagatgtatcttcagacagtctttcttttgtatcaccttcactgcaaatggaagactccaattcaaacaaggagaacatggcaaccttgtttacaatttggtgtactctgtgtgaccgcgcctatccctcggactgtcccgaacatggaccagtgacttttgttcctgacactccaatagagagcagagcaaggctttctctcccaaagcagcttgttctccgtcagtcaattgtgggagcagaagttggtgtatggactggagaaaccattcctgtgcggacttgctttggacctctaattggccagcagagtcactccatggaagtagcagaatggacagacaaggcagttaaccatatctggaagatataccacaatggtgtcctagaattctgcatcattacaactgatgaaaatgaatgtaattggatgatgtttgtgcgcaaagccaggaaccgggaagagcagaatttggtggcttatcctcatgatggaaaaatctttttctgcacctcacaagatatccctcctgaaaatgaactgcttttttattatagccgagattatgctcaacagattggtgttcctgaacacccagatgtgcatctctgtaactgtggcaaggagtgcaattcttacacagagttcaaagcccatctgaccagccacatccataaccatcttcctacccagggacatagcggcagccatgggccaagtcacagcaaagaaaggaagtggaagtgctcaatgtgcccccaagcttttatctctccttccaaacttcatgtccactttatgggtcacatgggtatgaagccccacaagtgtgatttctgtagcaaggcttttagtgatcccagcaacctgcggacccacctcaagatacatacaggtcagaagaactacaggtgtaccttgtgtgacaagtctttcacccagaaggctcacctggagtcccacatggttatccacactggggagaagaatcttaagtgtgattactgtgacaagttgtttatgcggaggcaggacctcaagcagcacgtgctcatccacactcaagaacgccagatcaagtgtcccaagtgtgataagctgttcttgagaacaaatcacttaaagaagcatctcaattctcatgaaggaaaacgggattatgtctgtgaaaaatgtacaaaggcttatctaaccaaataccatctcacccgccacctgaaaacctgcaaagggcccacctccagttcgtcagcaccagaggaggaagaagaggatgactcagaagaggaagatctagcagactctgtggggacagaagactgtaggattaacagtgctgtgtattcagcggatgagtctctttctgcacataaataa
Sequence Length
2406
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
87,920 Da
NCBI Official Full Name
Homo sapiens PR domain containing 4, mRNA
NCBI Official Synonym Full Names
PR/SET domain 4
NCBI Official Symbol
PRDM4
NCBI Official Synonym Symbols
PFM1
NCBI Protein Information
PR domain zinc finger protein 4
UniProt Protein Name
PR domain zinc finger protein 4
UniProt Gene Name
PRDM4
UniProt Synonym Gene Names
PFM1
UniProt Entry Name
PRDM4_HUMAN

NCBI Description

The protein encoded by this gene is a transcription factor of the PR-domain protein family. It contains a PR-domain and multiple zinc finger motifs. Transcription factors of the PR-domain family are known to be involved in cell differentiation and tumorigenesis. An elevated expression level of this gene has been observed in PC12 cells treated with nerve growth factor, beta polypeptide (NGF). This gene is located in a chromosomal region that is thought to contain tumor suppressor genes. [provided by RefSeq, Jul 2008]

Uniprot Description

PRDM4: May function as a transcription factor involved in cell differentiation.

Protein type: C2H2-type zinc finger protein; Methyltransferase, protein lysine, predicted

Chromosomal Location of Human Ortholog: 12q23-q24.1

Molecular Function: protein binding; zinc ion binding

Biological Process: cell proliferation; signal transduction

Research Articles on PRDM4

Similar Products

Product Notes

The PRDM4 prdm4 (Catalog #AAA1278987) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcatcaca ggatgaatga aatgaacctg agtccagtgg ggatggagca gctgacttca tcctctgtga gcaatgcctt gccagtctca ggaagtcacc tgggattggc tgcctcaccc actcacagtg ccatccctgc cccaggcctc ccagtggcaa ttccaaacct gggtccctcc ctgagctctc tgccttctgc tctgtcttta atgctaccaa tgggtattgg ggatcgaggg gtgatgtgtg ggttacctga aagaaactac accctacctc caccacctta ccctcacctg gagagcagtt atttcagaac cattctacct ggcattttat cttatttagc tgacagacca cctccacagt acatccaccc taactctata aatgttgatg gtaatacagc attatctatc accaataacc cttcagcact agatccctat cagtccaatg gaaatgttgg attagaacca ggcattgttt caatagactc tcgctctgtg aacacacatg gtgcccaaag tcttcatccc agtgatggcc atgaggtggc cttggacaca gcaatcacta tggagaacgt ttctagggtt accagcccaa tttcgacaga tggaatggca gaggagctta cgatggacgg tgttgcaggc gagcattccc aaatcccaaa tggctccaga agtcatgaac ctctgtctgt ggattctgtg agcaacaacc ttgcagcaga cgctgtagga catggtggtg tgatacccat gcatgggaat ggcctggagc tccctgtggt catggagaca gaccacattg caagtcgggt caatggcatg tctgacagtg ccctcagtga ctccattcac actgtggcca tgagcaccaa ctctgtaagc gtggcactct ctacctcaca caaccttgcc tccctagaat ctgtttccct ccatgaagtt ggcctcagcc tagaacctgt ggctgtctcc tccatcaccc aggaggttgc tatggggaca ggtcatgtag atgtatcttc agacagtctt tcttttgtat caccttcact gcaaatggaa gactccaatt caaacaagga gaacatggca accttgttta caatttggtg tactctgtgt gaccgcgcct atccctcgga ctgtcccgaa catggaccag tgacttttgt tcctgacact ccaatagaga gcagagcaag gctttctctc ccaaagcagc ttgttctccg tcagtcaatt gtgggagcag aagttggtgt atggactgga gaaaccattc ctgtgcggac ttgctttgga cctctaattg gccagcagag tcactccatg gaagtagcag aatggacaga caaggcagtt aaccatatct ggaagatata ccacaatggt gtcctagaat tctgcatcat tacaactgat gaaaatgaat gtaattggat gatgtttgtg cgcaaagcca ggaaccggga agagcagaat ttggtggctt atcctcatga tggaaaaatc tttttctgca cctcacaaga tatccctcct gaaaatgaac tgctttttta ttatagccga gattatgctc aacagattgg tgttcctgaa cacccagatg tgcatctctg taactgtggc aaggagtgca attcttacac agagttcaaa gcccatctga ccagccacat ccataaccat cttcctaccc agggacatag cggcagccat gggccaagtc acagcaaaga aaggaagtgg aagtgctcaa tgtgccccca agcttttatc tctccttcca aacttcatgt ccactttatg ggtcacatgg gtatgaagcc ccacaagtgt gatttctgta gcaaggcttt tagtgatccc agcaacctgc ggacccacct caagatacat acaggtcaga agaactacag gtgtaccttg tgtgacaagt ctttcaccca gaaggctcac ctggagtccc acatggttat ccacactggg gagaagaatc ttaagtgtga ttactgtgac aagttgttta tgcggaggca ggacctcaag cagcacgtgc tcatccacac tcaagaacgc cagatcaagt gtcccaagtg tgataagctg ttcttgagaa caaatcactt aaagaagcat ctcaattctc atgaaggaaa acgggattat gtctgtgaaa aatgtacaaa ggcttatcta accaaatacc atctcacccg ccacctgaaa acctgcaaag ggcccacctc cagttcgtca gcaccagagg aggaagaaga ggatgactca gaagaggaag atctagcaga ctctgtgggg acagaagact gtaggattaa cagtgctgtg tattcagcgg atgagtctct ttctgcacat aaataa. It is sometimes possible for the material contained within the vial of "PRDM4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.