PPP2R2D cdna clone
PPP2R2D cDNA Clone
Gene Names
PPP2R2D; MDS026
Synonyms
PPP2R2D; PPP2R2D cDNA Clone; PPP2R2D cdna clone
Sequence
atggcaggagccggaggcggcggctgccccgcgggcggcaacgacttccagtggtgcttctcgcaggtcaagggggccatcgacgaggacgtggccgaagcggacatcatttccaccgttgagtttaattactctggagatcttcttgcaacaggagacaagggcggcagagttgttatttttcagcgtgaacaagagaataaaagccgccctcattctaggggagaatataatgtttacagcacctttcaaagtcatgaaccggagtttgactatttgaaaagtctagaaattgaggaaaaaattaataaaattaggtggttaccacaacagaatgctgctcattttctactgtctacaaatgataaaactataaaattatggaaaataagtgaacgggataaaagagcagaaggttataacctgaaagacgaagatggaagacttcgagacccatttaggatcacggcgctacgggtcccaatattgaagcccatggatcttatggtagaagcgagtccacggcgaatttttgcaaatgctcacacatatcatataaattccatttcagtaaatagtgatcatgaaacatatctttctgcagatgacctgagaattaatttatggcacttagaaatcacagatagaagctttaacatcgtggacatcaagcctgctaacatggaggagctgaccgaagtcatcactgcagccgagttccacccgcaccagtgcaacgtgttcgtctacagcagtagcaaagggaccatccgcctgtgtgacatgcgctcctcggccctgtgcgacagacactccaagttttttgaagagcctgaagatcccagcagtaggtccttcttctcagaaataatttcatccatatccgatgtaaaattcagtcatagtgggcggtacatgatgaccagagactacctgtcggtgaaggtgtgggacctcaacatggagagcaggccggtggagacccaccaggtccacgagtacctgcgcagcaagctctgctctctctatgagaacgactgcatctttgacaagtttgagtgttgctggaacggttcggatagcgccatcatgaccgggtcctataacaacttcttcaggatgtttgatagagacacgcggagggatgtgaccctggaggcctcgagagagagcagcaaaccgcgcgccagcctcaaaccccggaaggtgtgtacggggggtaagcggaggaaagacgagatcagtgtggacagtctggacttcaacaagaagatcctgcacacagcctggcaccccgtggacaatgtcattgccgtggctgccaccaataacttgtacatattccaggacaaaatcaactag
Sequence Length
1362
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
52,042 Da
NCBI Official Full Name
Homo sapiens protein phosphatase 2, regulatory subunit B, delta isoform, mRNA
NCBI Official Synonym Full Names
protein phosphatase 2 regulatory subunit Bdelta
NCBI Official Symbol
PPP2R2D
NCBI Official Synonym Symbols
MDS026
NCBI Protein Information
serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B delta isoform
UniProt Protein Name
Serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B delta isoform
Protein Family
UniProt Gene Name
PPP2R2D
UniProt Synonym Gene Names
KIAA1541
UniProt Entry Name
2ABD_HUMAN
Uniprot Description
PPP2R2D: B regulatory subunit of protein phosphatase 2A (PP2A) that plays a key role in cell cycle by controlling mitosis entry and exit. The activity of PP2A complexes containing PPP2R2D (PR55- delta) fluctuate during the cell cycle: the activity is high in interphase and low in mitosis. During mitosis, activity of PP2A is inhibited via interaction with phosphorylated ENSA and ARPP19 inhibitors. Within the PP2A complexes, the B regulatory subunits modulate substrate selectivity and catalytic activity, and also may direct the localization of the catalytic enzyme to a particular subcellular compartment. Belongs to the phosphatase 2A regulatory subunit B family.
Protein type: Protein phosphatase, regulatory subunit
Chromosomal Location of Human Ortholog: 10q26.3
Cellular Component: protein phosphatase type 2A complex
Molecular Function: protein phosphatase type 2A regulator activity
Biological Process: exit from mitosis; mitosis
Research Articles on PPP2R2D
Similar Products
Product Notes
The PPP2R2D ppp2r2d (Catalog #AAA1265970) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaggag ccggaggcgg cggctgcccc gcgggcggca acgacttcca gtggtgcttc tcgcaggtca agggggccat cgacgaggac gtggccgaag cggacatcat ttccaccgtt gagtttaatt actctggaga tcttcttgca acaggagaca agggcggcag agttgttatt tttcagcgtg aacaagagaa taaaagccgc cctcattcta ggggagaata taatgtttac agcacctttc aaagtcatga accggagttt gactatttga aaagtctaga aattgaggaa aaaattaata aaattaggtg gttaccacaa cagaatgctg ctcattttct actgtctaca aatgataaaa ctataaaatt atggaaaata agtgaacggg ataaaagagc agaaggttat aacctgaaag acgaagatgg aagacttcga gacccattta ggatcacggc gctacgggtc ccaatattga agcccatgga tcttatggta gaagcgagtc cacggcgaat ttttgcaaat gctcacacat atcatataaa ttccatttca gtaaatagtg atcatgaaac atatctttct gcagatgacc tgagaattaa tttatggcac ttagaaatca cagatagaag ctttaacatc gtggacatca agcctgctaa catggaggag ctgaccgaag tcatcactgc agccgagttc cacccgcacc agtgcaacgt gttcgtctac agcagtagca aagggaccat ccgcctgtgt gacatgcgct cctcggccct gtgcgacaga cactccaagt tttttgaaga gcctgaagat cccagcagta ggtccttctt ctcagaaata atttcatcca tatccgatgt aaaattcagt catagtgggc ggtacatgat gaccagagac tacctgtcgg tgaaggtgtg ggacctcaac atggagagca ggccggtgga gacccaccag gtccacgagt acctgcgcag caagctctgc tctctctatg agaacgactg catctttgac aagtttgagt gttgctggaa cggttcggat agcgccatca tgaccgggtc ctataacaac ttcttcagga tgtttgatag agacacgcgg agggatgtga ccctggaggc ctcgagagag agcagcaaac cgcgcgccag cctcaaaccc cggaaggtgt gtacgggggg taagcggagg aaagacgaga tcagtgtgga cagtctggac ttcaacaaga agatcctgca cacagcctgg caccccgtgg acaatgtcat tgccgtggct gccaccaata acttgtacat attccaggac aaaatcaact ag. It is sometimes possible for the material contained within the vial of "PPP2R2D, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
