Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPP1R3C cdna clone

PPP1R3C cDNA Clone

Gene Names
PPP1R3C; PPP1R5
Synonyms
PPP1R3C; PPP1R3C cDNA Clone; PPP1R3C cdna clone
Ordering
For Research Use Only!
Sequence
atgagctgcaccagaatgatccaggttttagatccacgtcctttgacaagttcggtcatgcccgtggatgtggccatgaggctttgcttggcacattcaccacctgtgaagagtttcctgggcccgtacgatgaatttcaacgacgacattttgtgaataaattaaagcccctgaaatcatgtctcaatataaaacacaaagccaaatcacagaatgactggaagtgctcacacaaccaagccaagaagcgcgttgtgtttgctgactccaagggcctctctctcactgcgatccatgtcttctccgacctcccagaagaaccagcgtgggatctgcagtttgatctcttggaccttaatgatatctcctctgccttaaaacaccacgaggagaaaaacttgattttagatttccctcagccttcaaccgattacttaagtttccggagccactttcagaagaactttgtctgtctggagaactgctcattgcaagagcgaacagtgacagggactgttaaagtcaaaaatgtgagttttgagaagaaagttcagatccgtatcactttcgattcttggaaaaactacactgacgtagactgtgtctatatgaaaaatgtgtatggtggcacagatagtgataccttctcatttgccattgacttaccccctgtcattccaactgagcagaaaattgagttctgcatttcttaccatgctaatgggcaagtcttttgggacaacaatgatggtcagaattatagaattgttcatgttcaatggaagcctgatggggtgcagacacagatggcaccccaggactgtgcattccaccagacgtctcctaagacagagttagagtcaacaatctttggcagtccgaggctggctagtgggctcttcccagagtggcagagctgggggagaatggagaacttggcctcttatcgatga
Sequence Length
954
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,445 Da
NCBI Official Full Name
Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 3C, mRNA
NCBI Official Synonym Full Names
protein phosphatase 1 regulatory subunit 3C
NCBI Official Symbol
PPP1R3C
NCBI Official Synonym Symbols
PPP1R5
NCBI Protein Information
protein phosphatase 1 regulatory subunit 3C
UniProt Protein Name
Protein phosphatase 1 regulatory subunit 3C
UniProt Gene Name
PPP1R3C
UniProt Synonym Gene Names
PP1 subunit R5; PTG
UniProt Entry Name
PPR3C_HUMAN

NCBI Description

This gene encodes a regulatory subunit of protein phosphatase-1 (PP1). PP1 catalyzes reversible protein phosphorylation, which is important in a wide range of cellular activities: neuronal, muscular, RNA splicing, protein synthesis, cell death, and glycogen metabolism, to name just a few. By interacting with different regulatory subunits, PP1 is directed to different parts of the cell, to different substrates, or to respond to extracellular signals. [provided by RefSeq, Oct 2011]

Uniprot Description

PPP1R3C: Acts as a glycogen-targeting subunit for PP1 and regulates its activity. Activates glycogen synthase, reduces glycogen phosphorylase activity and limits glycogen breakdown. Dramatically increases basal and insulin-stimulated glycogen synthesis upon overexpression in a variety of cell types.

Protein type: Motility/polarity/chemotaxis; Protein phosphatase, regulatory subunit

Chromosomal Location of Human Ortholog: 10q23-q24

Cellular Component: cytosol

Molecular Function: protein binding; protein phosphatase binding; protein serine/threonine phosphatase activity

Biological Process: glycogen biosynthetic process; glycogen metabolic process

Research Articles on PPP1R3C

Similar Products

Product Notes

The PPP1R3C ppp1r3c (Catalog #AAA1270150) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagctgca ccagaatgat ccaggtttta gatccacgtc ctttgacaag ttcggtcatg cccgtggatg tggccatgag gctttgcttg gcacattcac cacctgtgaa gagtttcctg ggcccgtacg atgaatttca acgacgacat tttgtgaata aattaaagcc cctgaaatca tgtctcaata taaaacacaa agccaaatca cagaatgact ggaagtgctc acacaaccaa gccaagaagc gcgttgtgtt tgctgactcc aagggcctct ctctcactgc gatccatgtc ttctccgacc tcccagaaga accagcgtgg gatctgcagt ttgatctctt ggaccttaat gatatctcct ctgccttaaa acaccacgag gagaaaaact tgattttaga tttccctcag ccttcaaccg attacttaag tttccggagc cactttcaga agaactttgt ctgtctggag aactgctcat tgcaagagcg aacagtgaca gggactgtta aagtcaaaaa tgtgagtttt gagaagaaag ttcagatccg tatcactttc gattcttgga aaaactacac tgacgtagac tgtgtctata tgaaaaatgt gtatggtggc acagatagtg ataccttctc atttgccatt gacttacccc ctgtcattcc aactgagcag aaaattgagt tctgcatttc ttaccatgct aatgggcaag tcttttggga caacaatgat ggtcagaatt atagaattgt tcatgttcaa tggaagcctg atggggtgca gacacagatg gcaccccagg actgtgcatt ccaccagacg tctcctaaga cagagttaga gtcaacaatc tttggcagtc cgaggctggc tagtgggctc ttcccagagt ggcagagctg ggggagaatg gagaacttgg cctcttatcg atga. It is sometimes possible for the material contained within the vial of "PPP1R3C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.