Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPP1R1B cdna clone

PPP1R1B cDNA Clone

Gene Names
PPP1R1B; DARPP32; DARPP-32
Synonyms
PPP1R1B; PPP1R1B cDNA Clone; PPP1R1B cdna clone
Ordering
For Research Use Only!
Sequence
atgctgttccggctctcagagcactcctcaccagaggaggaagcctccccccaccagagagcctcaggagaggggcaccatctcaagtcgaagagacccaacccctgtgcctacacaccaccttcgctgaaagctgtgcagcgcattgctgagtctcacctgcagtctatcagcaatttgaatgagaaccaggcctcagaggaggaggatgagctgggggagcttcgggagctgggttatccaagagaggaagatgaggaggaagaggaggatgatgaagaagaggaagaagaagaggacagccaggctgaagtcctgaaggtcatcaggcagtctgctgggcaaaagacaacctgtggccagggtctggaagggccctgggagcgcccaccccctctggatgagtccgagagagatggaggctctgaggaccaagtggaagacccagcactaagtgagcctggggaggaacctcagcgcccttccccctctgagcctggcacatag
Sequence Length
507
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,738 Da
NCBI Official Full Name
Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 1B, mRNA
NCBI Official Synonym Full Names
protein phosphatase 1 regulatory inhibitor subunit 1B
NCBI Official Symbol
PPP1R1B
NCBI Official Synonym Symbols
DARPP32; DARPP-32
NCBI Protein Information
protein phosphatase 1 regulatory subunit 1B
UniProt Protein Name
Protein phosphatase 1 regulatory subunit 1B
UniProt Gene Name
PPP1R1B
UniProt Synonym Gene Names
DARPP32
UniProt Entry Name
PPR1B_HUMAN

NCBI Description

This gene encodes a bifunctional signal transduction molecule. Dopaminergic and glutamatergic receptor stimulation regulates its phosphorylation and function as a kinase or phosphatase inhibitor. As a target for dopamine, this gene may serve as a therapeutic target for neurologic and psychiatric disorders. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Uniprot Description

DARPP-32: a member of the protein phosphatase inhibitor 1 family. A dopamine- and cyclic AMP-regulated neuronal phosphoprotein. Both dopaminergic and glutamatergic (NMDA) receptor stimulation regulate the extent of DARPP32 phosphorylation, but in opposite directions. Dopamine D1 receptor stimulation enhances cAMP formation, resulting in the phosphorylation of DARPP32; phosphorylated DARPP32 is a potent protein phosphatase-1 inhibitor. NMDA receptor stimulation elevates intracellular calcium, which leads to activation of calcineurin and dephosphorylation of phospho-DARPP32, thereby reducing the phosphatase-1 inhibitory activity of DARPP32. Two alternatively-spliced isoforms have been described.

Protein type: Motility/polarity/chemotaxis; Protein phosphatase, regulatory subunit

Chromosomal Location of Human Ortholog: 17q12

Cellular Component: cytoplasm; cytosol

Molecular Function: cAMP-dependent protein kinase inhibitor activity; protein binding; protein kinase inhibitor activity; protein phosphatase inhibitor activity; protein phosphatase type 1 regulator activity; type 1 serine/threonine specific protein phosphatase inhibitor activity

Biological Process: signal transduction

Research Articles on PPP1R1B

Similar Products

Product Notes

The PPP1R1B ppp1r1b (Catalog #AAA1270212) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgttcc ggctctcaga gcactcctca ccagaggagg aagcctcccc ccaccagaga gcctcaggag aggggcacca tctcaagtcg aagagaccca acccctgtgc ctacacacca ccttcgctga aagctgtgca gcgcattgct gagtctcacc tgcagtctat cagcaatttg aatgagaacc aggcctcaga ggaggaggat gagctggggg agcttcggga gctgggttat ccaagagagg aagatgagga ggaagaggag gatgatgaag aagaggaaga agaagaggac agccaggctg aagtcctgaa ggtcatcagg cagtctgctg ggcaaaagac aacctgtggc cagggtctgg aagggccctg ggagcgccca ccccctctgg atgagtccga gagagatgga ggctctgagg accaagtgga agacccagca ctaagtgagc ctggggagga acctcagcgc ccttccccct ctgagcctgg cacatag. It is sometimes possible for the material contained within the vial of "PPP1R1B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.