Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPM1K cdna clone

PPM1K cDNA Clone

Gene Names
PPM1K; BDP; PTMP; PP2Cm; MSUDMV; PP2Ckappa; UG0882E07
Synonyms
PPM1K; PPM1K cDNA Clone; PPM1K cdna clone
Ordering
For Research Use Only!
Sequence
atgtcaacagctgccttaattactttggtcagaagtggtgggaaccaggtgagaaggagagtgctgctaagctcccgcctgctgcaggacgacaggcgggtgacacccacgtgccacagctccacttcagagcctaggtgttctcggtttgacccagatggtagtgggagtccagctacctgggacaattttgggatctgggataaccgcattgatgagccaattctgctgccacccagcattaagtatggcaagccaattcccaaaatcagcttggaaaaggtggggtgcgcctcacagattggcaaacggaaagagaatgaagatcggtttgacttcgctcagctgacagatgaggtcctgtactttgcagtgtatgatggacacggtggacctgcagcagctgatttctgtcatacccacatggagaaatgtattatggatttgcttcctaaggagaagaacttggaaactctgttgaccttggcttttctagaaatagataaagccttttcgagtcatgcccgcctgtctgctgatgcaactcttctgacctctgggactactgcaacagtagccctattgcgagatggtattgaactggttgtagccagtgttggggacagccgggctattttgtgtagaaaaggaaaacccatgaagctgaccattgaccatactccagaaagaaaagatgaaaaagaaaggatcaagaaatgtggtggttttgtagcttggaatagtttggggcagcctcacgtaaatggcaggcttgcaatgacaagaagtattggagatttggaccttaagaccagtggtgtcatagcagaacctgaaactaagaggattaagttacatcatgctgatgacagcttcctggtcctcaccacagatggaattaacttcatggtgaatagtcaagagatttgtgactttgtcaatcagtgccatgatcccaacgaagcagcccatgcggtgactgaacaggcaatacagtacggtactgaggataacagtactgcagtagtagtgccttttggtgcctggggaaaatataagaactctgaaatcaacttctcattcagcagaagctttgcctccagtggacgatgggcctga
Sequence Length
1119
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,759 Da
NCBI Official Full Name
Homo sapiens protein phosphatase 1K (PP2C domain containing), mRNA
NCBI Official Synonym Full Names
protein phosphatase, Mg2+/Mn2+ dependent 1K
NCBI Official Symbol
PPM1K
NCBI Official Synonym Symbols
BDP; PTMP; PP2Cm; MSUDMV; PP2Ckappa; UG0882E07
NCBI Protein Information
protein phosphatase 1K, mitochondrial
UniProt Protein Name
Protein phosphatase 1K, mitochondrial
Protein Family
UniProt Gene Name
PPM1K
UniProt Synonym Gene Names
PP2CM; PTMP; PP2C-kappa
UniProt Entry Name
PPM1K_HUMAN

NCBI Description

This gene encodes a member of the PPM family of Mn2+/Mg2+-dependent protein phosphatases. The encoded protein, essential for cell survival and development, is targeted to the mitochondria where it plays a key role in regulation of the mitochondrial permeability transition pore. [provided by RefSeq, Sep 2012]

Uniprot Description

PPM1K: Regulates the mitochondrial permeability transition pore and is essential for cellular survival and development. Belongs to the PP2C family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; EC 3.1.3.16; Protein phosphatase, Ser/Thr (non-receptor); Mitochondrial

Chromosomal Location of Human Ortholog: 4q22.1

Cellular Component: mitochondrial matrix; mitochondrion

Molecular Function: protein binding; protein serine/threonine phosphatase activity

Biological Process: branched chain family amino acid catabolic process

Disease: Maple Syrup Urine Disease, Mild Variant

Research Articles on PPM1K

Similar Products

Product Notes

The PPM1K ppm1k (Catalog #AAA1271546) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcaacag ctgccttaat tactttggtc agaagtggtg ggaaccaggt gagaaggaga gtgctgctaa gctcccgcct gctgcaggac gacaggcggg tgacacccac gtgccacagc tccacttcag agcctaggtg ttctcggttt gacccagatg gtagtgggag tccagctacc tgggacaatt ttgggatctg ggataaccgc attgatgagc caattctgct gccacccagc attaagtatg gcaagccaat tcccaaaatc agcttggaaa aggtggggtg cgcctcacag attggcaaac ggaaagagaa tgaagatcgg tttgacttcg ctcagctgac agatgaggtc ctgtactttg cagtgtatga tggacacggt ggacctgcag cagctgattt ctgtcatacc cacatggaga aatgtattat ggatttgctt cctaaggaga agaacttgga aactctgttg accttggctt ttctagaaat agataaagcc ttttcgagtc atgcccgcct gtctgctgat gcaactcttc tgacctctgg gactactgca acagtagccc tattgcgaga tggtattgaa ctggttgtag ccagtgttgg ggacagccgg gctattttgt gtagaaaagg aaaacccatg aagctgacca ttgaccatac tccagaaaga aaagatgaaa aagaaaggat caagaaatgt ggtggttttg tagcttggaa tagtttgggg cagcctcacg taaatggcag gcttgcaatg acaagaagta ttggagattt ggaccttaag accagtggtg tcatagcaga acctgaaact aagaggatta agttacatca tgctgatgac agcttcctgg tcctcaccac agatggaatt aacttcatgg tgaatagtca agagatttgt gactttgtca atcagtgcca tgatcccaac gaagcagccc atgcggtgac tgaacaggca atacagtacg gtactgagga taacagtact gcagtagtag tgccttttgg tgcctgggga aaatataaga actctgaaat caacttctca ttcagcagaa gctttgcctc cagtggacga tgggcctga. It is sometimes possible for the material contained within the vial of "PPM1K, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.