Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPA2 cdna clone

PPA2 cDNA Clone

Gene Names
PPA2; HSPC124; SID6-306
Synonyms
PPA2; PPA2 cDNA Clone; PPA2 cdna clone
Ordering
For Research Use Only!
Sequence
atgagcgcgctgctgcggctgctgcgcacgggtgccccagccgctgcgtgcctgcggttggggaccagtgcagggaccgggtcgcgccgtgctatggccctgtaccacactgaggagcgcggccagccctgctcgcagaattaccgcctcttctttaagaatgtaactggtcactacatttccccctttcatgatattcctctgaaggtgaactctaaagaggaaaatggcattcctatgaagaaagcacgaaatgatgaatatgagaatctgtttaatatgattgtagaaatacctcggtggacaaatgctaaaatggagattgccaccaaggagccaatgaatcccattaaacaatatgtaaaggatggaaagctacgctatgtggcgaatatcttcccttacaagggttatatatggaattatggtaccctccctcagattctttcttgtggagaagttattcatgtgaagatccttggaattttggctcttattgatgaaggtgaaacagattggaaattaattgctatcaatgcgaatgatcctgaagcctcaaagtttcatgatattgatgatgttaagaagttcaaaccgggttacctggaagctactcttaattggtttagattatataaggtaccagatggaaaaccagaaaaccagtttgcttttaatggagaattcaaaaacaaggcttttgctcttgaagttattaaatccactcatcaatgttggaaagcattgcttatgaagaagtgtaatggaggagctataaattgcacaaacgtgcagatatctgatagccctttccgttgcactcaagaggaagcaagatcattagttgaatcggtatcatcttcaccaaataaagaaagtaatgaagaagagcaagtgtggcacttccttggcaagtga
Sequence Length
918
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,992 Da
NCBI Official Full Name
Homo sapiens pyrophosphatase (inorganic) 2, mRNA
NCBI Official Synonym Full Names
pyrophosphatase (inorganic) 2
NCBI Official Symbol
PPA2
NCBI Official Synonym Symbols
HSPC124; SID6-306
NCBI Protein Information
inorganic pyrophosphatase 2, mitochondrial
UniProt Protein Name
Inorganic pyrophosphatase 2, mitochondrial
UniProt Gene Name
PPA2
UniProt Synonym Gene Names
PPase 2
UniProt Entry Name
IPYR2_HUMAN

NCBI Description

The protein encoded by this gene is localized to the mitochondrion, is highly similar to members of the inorganic pyrophosphatase (PPase) family, and contains the signature sequence essential for the catalytic activity of PPase. PPases catalyze the hydrolysis of pyrophosphate to inorganic phosphate, which is important for the phosphate metabolism of cells. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

PPA2: is localized to the mitochondrion, is highly similar to members of the inorganic pyrophosphatase (PPase) family, and contains the signature sequence essential for the catalytic activity of PPase. PPases catalyze the hydrolysis of pyrophosphate to inorganic phosphate, which is important for the phosphate metabolism of cells. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Protein type: Mitochondrial; Energy Metabolism - oxidative phosphorylation; EC 3.6.1.1; Hydrolase

Chromosomal Location of Human Ortholog: 4q25

Cellular Component: mitochondrial matrix

Molecular Function: inorganic diphosphatase activity

Biological Process: tRNA aminoacylation for protein translation

Research Articles on PPA2

Similar Products

Product Notes

The PPA2 ppa2 (Catalog #AAA1276308) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcgcgc tgctgcggct gctgcgcacg ggtgccccag ccgctgcgtg cctgcggttg gggaccagtg cagggaccgg gtcgcgccgt gctatggccc tgtaccacac tgaggagcgc ggccagccct gctcgcagaa ttaccgcctc ttctttaaga atgtaactgg tcactacatt tccccctttc atgatattcc tctgaaggtg aactctaaag aggaaaatgg cattcctatg aagaaagcac gaaatgatga atatgagaat ctgtttaata tgattgtaga aatacctcgg tggacaaatg ctaaaatgga gattgccacc aaggagccaa tgaatcccat taaacaatat gtaaaggatg gaaagctacg ctatgtggcg aatatcttcc cttacaaggg ttatatatgg aattatggta ccctccctca gattctttct tgtggagaag ttattcatgt gaagatcctt ggaattttgg ctcttattga tgaaggtgaa acagattgga aattaattgc tatcaatgcg aatgatcctg aagcctcaaa gtttcatgat attgatgatg ttaagaagtt caaaccgggt tacctggaag ctactcttaa ttggtttaga ttatataagg taccagatgg aaaaccagaa aaccagtttg cttttaatgg agaattcaaa aacaaggctt ttgctcttga agttattaaa tccactcatc aatgttggaa agcattgctt atgaagaagt gtaatggagg agctataaat tgcacaaacg tgcagatatc tgatagccct ttccgttgca ctcaagagga agcaagatca ttagttgaat cggtatcatc ttcaccaaat aaagaaagta atgaagaaga gcaagtgtgg cacttccttg gcaagtga. It is sometimes possible for the material contained within the vial of "PPA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.