POLR2E cdna clone

POLR2E

Cat. Num. AAA200840

• Gene Names: POLR2E; RPB5; XAP4; RPABC1; hRPB25; hsRPB5
• Synonyms: POLR2E; hRPB25; hsRPB5; RPABC1; RPB5; XAP4; POLR2E cdna clone

• Form/Format: Lyophilized
• Sequence: Nucleotide Sequence: ATGGACGACGAGGAGGAGACGTACCGGCTCTGGAAAATCCGCAAGACCATCATGCAGCTGTGCCACGACCGTGGCTATCTGGTGACCCAGGACGAGCTTGACCAGACCCTGGAGGAGTTCAAAGCCCAATTTGGGGACAAGCCGAGTGAGGGGCGGCCGCGGCGCACGGACCTCACCGTGCTGGTGGCCCACAACGATGACCCCACCGACCAGATGTTTGTGTTCTTTCCAGAGGAGCCCAAGGTGGGCATCAAGACCATCAAGGTGTACTGCCAGCGCATGCAGGAGGAGAACATCACACGGGCTCTCATCGTGGTGCAGCAGGGCATGACACCCTCCGCCAAGCAGTCCCTGGTCGACATGGCCCCCAAGTACATCCTGGAGCAGTTTCTGCAGCAGGAGCTGCTCATCAACATCACGGAGCACGAGCTAGTCCCTGAGCACGTCGTCATGACCAAGGAGGAGGTGACAGAGCTGCTGGCCCGATATAAGCTCCGAGAGAACCAGCTGCCCAGGATCCAGGCGGGGGACCCTGTGGCGCGCTACTTTGGGATAAAGCGTGGGCAGGTGGTGAAGATCATCCGGCCCAGTGAGACGGCTGGCAGGTACATCACCTACCGGCTGGTGCAGTAG; ; Translation Sequence: MDDEEETYRL WKIRKTIMQL CHDRGYLVTQ DELDQTLEEF KAQFGDKPSE GRPRRTDLTV LVAHNDDPTD QMFVFFPEEP KVGIKTIKVY CQRMQEENIT RALIVVQQGM TPSAKQSLVD MAPKYILEQF LQQELLINIT EHELVPEHVV MTKEEVTELL ARYKLRENQL PRIQAGDPVA RYFGIKRGQV VKIIRPSETA GRYITYRLVQ
• Sequence Length: 210

• Species: Human
• Chromosome Location: 19p13.3
• OMIM Reference Number: 180664
• cDNA Size: 633bp
• Vector Description: This shuttle vector contains the complete ORF. It is inseted Nde I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
• Vector: (puc19-derived cloning vector)
• Preparation Before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
• Preparation and Storage: Store the plasmid at -20 degree C.

Related Product Information for POLR2E cdna clone

POLR2E encodes the fifth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This subunit is shared by the other two DNA-directed RNA polymerases and is present in two-fold molar excess over the other polymerase subunits. An interaction between this subunit and a hepatitis virus transactivating protein has been demonstrated, suggesting that interaction between transcriptional activators and the polymerase can occur through this subunit. A pseudogene is located on chromosome 11.

Product Categories/Family for POLR2E cdna clone

Epigenomics (Transcription & Translation)

NCBI and Uniprot Product Information

• NCBI GI #: 14589951
• NCBI GeneID: 5434
• NCBI Accession #: NP_002686.2
• NCBI GenBank Nucleotide #: NM_002695.3
• UniProt Accession #: P19388
• NCBI Official Full Name: DNA-directed RNA polymerases I, II, and III subunit RPABC1 isoform a
• NCBI Official Synonym Full Names: RNA polymerase II subunit E
• NCBI Official Symbol: POLR2E
• NCBI Official Synonym Symbols: RPB5; XAP4; RPABC1; hRPB25; hsRPB5
• NCBI Protein Information: DNA-directed RNA polymerases I, II, and III subunit RPABC1
• UniProt Protein Name: DNA-directed RNA polymerases I, II, and III subunit RPABC1
• UniProt Gene Name: POLR2E
• UniProt Synonym Gene Names: RNA polymerases I, II, and III subunit ABC1
• UniProt Entry Name: RPAB1_HUMAN

NCBI Description

This gene encodes the fifth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. This subunit is shared by the other two DNA-directed RNA polymerases and is present in two-fold molar excess over the other polymerase subunits. An interaction between this subunit and a hepatitis virus transactivating protein has been demonstrated, suggesting that interaction between transcriptional activators and the polymerase can occur through this subunit. A pseudogene is located on chromosome 11. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]

Uniprot Description

POLR2E: DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Common component of RNA polymerases I, II and III which synthesize ribosomal RNA precursors, mRNA precursors and many functional non-coding RNAs, and small RNAs, such as 5S rRNA and tRNAs, respectively. Pol II is the central component of the basal RNA polymerase II transcription machinery. Pols are composed of mobile elements that move relative to each other. In Pol II, POLR2E/RPB5 is part of the lower jaw surrounding the central large cleft and thought to grab the incoming DNA template. Seems to be the major component in this process. Belongs to the archaeal RpoH/eukaryotic RPB5 RNA polymerase subunit family.

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: nucleoplasm; DNA-directed RNA polymerase III complex; DNA-directed RNA polymerase II, core complex; nucleus; cytosol; DNA-directed RNA polymerase I complex

Molecular Function: protein binding; DNA binding; DNA-directed RNA polymerase activity

Biological Process: transcription from RNA polymerase II promoter; transcription initiation from RNA polymerase II promoter; termination of RNA polymerase III transcription; viral reproduction; positive regulation of viral transcription; somatic stem cell maintenance; RNA splicing; transcription from RNA polymerase I promoter; RNA elongation from RNA polymerase I promoter; termination of RNA polymerase I transcription; DNA repair; regulation of gene expression, epigenetic; nuclear mRNA splicing, via spliceosome; transcription from RNA polymerase III promoter; mRNA capping; nucleotide-excision repair; negative regulation of gene expression, epigenetic; transcription-coupled nucleotide-excision repair; RNA elongation from RNA polymerase II promoter; positive regulation of interferon type I production; innate immune response; gene expression; transcription initiation from RNA polymerase I promoter; RNA elongation from RNA polymerase III promoter