Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

POLR1E cdna clone

POLR1E cDNA Clone

Gene Names
POLR1E; PAF53; PRAF1
Synonyms
POLR1E; POLR1E cDNA Clone; POLR1E cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggaggtgttgccgagtgcgaggtggcagtattgtggggcgcccgacgggagccagagagctgtactggtccagttctccaacgggaagctacagagtccaggcaacatgcgctttaccttgtatgagaacaaagattccaccaaccccaggaagaggaatcaacggatcctggcagctgaaacagataggctctcctatgtgggaaacaattttgggactggagccctcaaatgcaacactttgtgcaggcactttgtgggaattttgaacaagacctctggccaaatggaagtatatgatgctgaattgttcaacatgcagccactattttcagatgtatcagttgagagtgaactggctctagagagtcagaccaaaacttacagagaaaagatggattcttgtattgaagcctttggtaccactaaacagaagcgagctctgaacaccaggagaatgaacagagttggcaatgaatctttgaatcgtgcagtggctaaagctgcagagactatcattgatacgaagggtgtgactgctctggtcagcgatgctatccacaatgacttgcaagatgactccctctaccttcctccctgctatgatgatgcagccaagcctgaagacgtgtataaatttgaagatcttctttcccctgcggagtatgaagctcttcagagcccatctgaagctttcaggaacgtcacgtcagaagaaatactgaagatgattgaggagaacagccattgcacctttgtcatagaagcgttgaagtctttgccatcagatgtggagagccgagaccgccaggcccgatgcatatggtttctggataccctcatcaaatttcgagctcatagggtagttaagcggaaaagtgctctgggacctggagttccccacatcatcaacaccaaactgctgaagcactttacctgcttgacctacaacaatggcagattacggaacttaatttcggattctatgaaggcgaagattactgcatatgtgatcatacttgccttgcacatacatgacttccaaattgacctgacagtgttacagagggacttgaagctcagtgagaaaaggatgatggagatagccaaagccatgaggctgaagatctccaaaagaaaggtgtctgtggccgccggcagtgaagaagatcacaaactgggcaccctgtccctcccgctgcctccagcccagacctcagaccgcctggcaaagcggaggaagattacctag
Sequence Length
1260
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,260 Da
NCBI Official Full Name
Homo sapiens polymerase (RNA) I polypeptide E, 53kDa, mRNA
NCBI Official Synonym Full Names
RNA polymerase I subunit E
NCBI Official Symbol
POLR1E
NCBI Official Synonym Symbols
PAF53; PRAF1
NCBI Protein Information
DNA-directed RNA polymerase I subunit RPA49
UniProt Protein Name
DNA-directed RNA polymerase I subunit RPA49
UniProt Gene Name
POLR1E
UniProt Synonym Gene Names
PAF53; PRAF1; RNA polymerase I subunit A49
UniProt Entry Name
RPA49_HUMAN

Uniprot Description

POLR1E: DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Component of RNA polymerase I which synthesizes ribosomal RNA precursors. Appears to be involved in the formation of the initiation complex at the promoter by mediating the interaction between Pol I and UBTF/UBF. Belongs to the eukaryotic RPA49/POLR1E RNA polymerase subunit family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Nucleotide Metabolism - pyrimidine; Nucleolus; Nucleotide Metabolism - purine

Chromosomal Location of Human Ortholog: 9p13.2

Cellular Component: DNA-directed RNA polymerase I complex; nucleolus; nucleoplasm; nucleus

Biological Process: positive regulation of gene expression, epigenetic; RNA elongation from RNA polymerase I promoter; rRNA transcription; termination of RNA polymerase I transcription; transcription initiation from RNA polymerase I promoter

Research Articles on POLR1E

Similar Products

Product Notes

The POLR1E polr1e (Catalog #AAA1266175) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg aggtgttgcc gagtgcgagg tggcagtatt gtggggcgcc cgacgggagc cagagagctg tactggtcca gttctccaac gggaagctac agagtccagg caacatgcgc tttaccttgt atgagaacaa agattccacc aaccccagga agaggaatca acggatcctg gcagctgaaa cagataggct ctcctatgtg ggaaacaatt ttgggactgg agccctcaaa tgcaacactt tgtgcaggca ctttgtggga attttgaaca agacctctgg ccaaatggaa gtatatgatg ctgaattgtt caacatgcag ccactatttt cagatgtatc agttgagagt gaactggctc tagagagtca gaccaaaact tacagagaaa agatggattc ttgtattgaa gcctttggta ccactaaaca gaagcgagct ctgaacacca ggagaatgaa cagagttggc aatgaatctt tgaatcgtgc agtggctaaa gctgcagaga ctatcattga tacgaagggt gtgactgctc tggtcagcga tgctatccac aatgacttgc aagatgactc cctctacctt cctccctgct atgatgatgc agccaagcct gaagacgtgt ataaatttga agatcttctt tcccctgcgg agtatgaagc tcttcagagc ccatctgaag ctttcaggaa cgtcacgtca gaagaaatac tgaagatgat tgaggagaac agccattgca cctttgtcat agaagcgttg aagtctttgc catcagatgt ggagagccga gaccgccagg cccgatgcat atggtttctg gataccctca tcaaatttcg agctcatagg gtagttaagc ggaaaagtgc tctgggacct ggagttcccc acatcatcaa caccaaactg ctgaagcact ttacctgctt gacctacaac aatggcagat tacggaactt aatttcggat tctatgaagg cgaagattac tgcatatgtg atcatacttg ccttgcacat acatgacttc caaattgacc tgacagtgtt acagagggac ttgaagctca gtgagaaaag gatgatggag atagccaaag ccatgaggct gaagatctcc aaaagaaagg tgtctgtggc cgccggcagt gaagaagatc acaaactggg caccctgtcc ctcccgctgc ctccagccca gacctcagac cgcctggcaa agcggaggaa gattacctag. It is sometimes possible for the material contained within the vial of "POLR1E, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.