Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

POLR1D cdna clone

POLR1D cDNA Clone

Gene Names
POLR1D; AC19; RPA9; TCS2; RPA16; RPAC2; RPC16; POLR1C; RPO1-3
Synonyms
POLR1D; POLR1D cDNA Clone; POLR1D cdna clone
Ordering
For Research Use Only!
Sequence
atggaagaggatcaggagctggagagaaaaatatctggattgaagacctcaatggctgaaggcgagaggaagacagccctggaaatggtccaggcagctggaacagatagacactgtgtgacatttgtattgcacgaggaagaccataccctaggaaattctctacgttacatgatcatgaagaacccggaagtggaattttgtggttacactacgacccatccttcagagagcaaaattaatttacgcattcagactcgaggtacccttccagctgttgagccatttcagagaggcctgaatgagctcatgaatgtctgccaacatgtgcttgacaagtttgaggccagcataaaggactataaggatcaaaaagcaagcagaaatgaatccacattctag
Sequence Length
402
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,332 Da
NCBI Official Full Name
Homo sapiens polymerase (RNA) I polypeptide D, 16kDa, mRNA
NCBI Official Synonym Full Names
RNA polymerase I subunit D
NCBI Official Symbol
POLR1D
NCBI Official Synonym Symbols
AC19; RPA9; TCS2; RPA16; RPAC2; RPC16; POLR1C; RPO1-3
NCBI Protein Information
DNA-directed RNA polymerases I and III subunit RPAC2
UniProt Protein Name
DNA-directed RNA polymerases I and III subunit RPAC2
UniProt Gene Name
POLR1D
UniProt Synonym Gene Names
RNA polymerases I and III subunit AC2; RPA16
UniProt Entry Name
RPAC2_HUMAN

NCBI Description

The protein encoded by this gene is a component of the RNA polymerase I and RNA polymerase III complexes, which function in the synthesis of ribosomal RNA precursors and small RNAs, respectively. Mutations in this gene are a cause of Treacher Collins syndrome (TCS), a craniofacial development disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2011]

Uniprot Description

POLR1D: DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Common core component of RNA polymerases I and III which synthesize ribosomal RNA precursors and small RNAs, such as 5S rRNA and tRNAs, respectively. Defects in POLR1D are the cause of Treacher Collins syndrome type 2 (TCS2). A form of Treacher Collins syndrome, a disorder of craniofacial development. Treacher Collins syndrome is characterized by a combination of bilateral downward slanting of the palpebral fissures, colobomas of the lower eyelids with a paucity of eyelashes medial to the defect, hypoplasia of the facial bones, cleft palate, malformation of the external ears, atresia of the external auditory canals, and bilateral conductive hearing loss. Belongs to the archaeal RpoL/eukaryotic RPB11/RPC19 RNA polymerase subunit family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Nucleotide Metabolism - pyrimidine; Nucleotide Metabolism - purine

Chromosomal Location of Human Ortholog: 13q12.2

Cellular Component: cytosol; DNA-directed RNA polymerase I complex; DNA-directed RNA polymerase III complex; nucleoplasm

Molecular Function: protein binding

Biological Process: positive regulation of gene expression, epigenetic; positive regulation of interferon type I production; RNA elongation from RNA polymerase I promoter; termination of RNA polymerase I transcription; transcription initiation from RNA polymerase I promoter

Research Articles on POLR1D

Similar Products

Product Notes

The POLR1D polr1d (Catalog #AAA1269118) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagagg atcaggagct ggagagaaaa atatctggat tgaagacctc aatggctgaa ggcgagagga agacagccct ggaaatggtc caggcagctg gaacagatag acactgtgtg acatttgtat tgcacgagga agaccatacc ctaggaaatt ctctacgtta catgatcatg aagaacccgg aagtggaatt ttgtggttac actacgaccc atccttcaga gagcaaaatt aatttacgca ttcagactcg aggtaccctt ccagctgttg agccatttca gagaggcctg aatgagctca tgaatgtctg ccaacatgtg cttgacaagt ttgaggccag cataaaggac tataaggatc aaaaagcaag cagaaatgaa tccacattct ag. It is sometimes possible for the material contained within the vial of "POLR1D, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.