PNPLA8 cdna clone

PNPLA8 cDNA Clone

Gene Names

PNPLA8; MMLA; IPLA2G; IPLA2-2; iPLA2gamma; PNPLA-gamma

Synonyms

PNPLA8; PNPLA8 cDNA Clone; PNPLA8 cdna clone

Ordering
Cat. Num. AAA1277307 For Research Use Only!

Sequence

atgtctattaatctgactgtagatatatatatttacctccttagtaatgcaagaagtgtttgtgggaagcagagaagcaagcaactgtatttcttgttctcacctaagcattactggaggataagccacatcagtctacaaagaggttttcatacaaacataataagatgtaaatggaccaaaagtgaagcacattcttgcagtaagcactgttactctccaagcaaccatggtttacatattgggattttgaaacttagcacttctgctcccaagggacttacaaaagtgaacatttgtatgtcccgtattaaaagtactttgaactctgtttcaaaggctgtttttggcaatcaaaatgaaatgatttcacgtttagctcaatttaagccaagttcccaaattttaagaaaagtatcggatagtggctggttaaaacagaaaaacatcaaacaagccatcaaatctctgaaaaaatatagtgacaaatcagcagaaaagagtccttttccagaagagaaaagtcacattatagacaaagaagaagatataggtaaacgcagtctttttcattacacaagttctataaccacaaaatttggagactcattctactttttatcaaatcatattaattcatatttcaaacgtaaggaaaaaatgtctcaacaaaaggaaaatgaacatttccgggacaaatcagaacttgaagataaaaaggtagaagaggggaaattaagatctccagatcctggcatcctggcttataagccaggctcagaatctgtacatacggtggacaagcctacaagtccttctgcgatacctgatgttcttcaagtttcaactaaacaaagtattgctaactttctttctcgtcccacggaaggtgtacaagctttagtaggtggttatattggtggacttgtccccaaattaaagtatgattcaaagagtcagtcagaagaacaggaagagcctgctaaaactgatcaggctgtcagcaaagacagaaatgcagaggagaaaaagcgtttatctcttcagcgagaaaagattatcgcaagggtgagtattgataacaggacccgggcattagttcaggcattaagaagaacaactgacccaaagctctgcattactagggttgaagaactgacttttcatcttctagaatttcctgaaggaaaaggagtggctgtcaaggaaagaattattccatatttattacgactgagacaaattaaggatgaaactcttcaggctgcagttagagaaattttggccctaattggctatgtggatccagtgaaagggagaggaatccgaattctctcaattgatggtggaggaacaaggggcgtggttgctctccagaccctacgaaaattagttgaacttactcagaagccagttcatcagctctttgattacatttgtggtgtaagcacaggtgccatattagctttcatgttggggttgtttcatatgcccttggatgaatgtgaggaactttatcgaaaattaggatcagatgtattttcacaaaatgtcattgttggaacagtaaaaatgagttggagccatgcattttatgacagtcaaacatgggaaaacattcttaaggataggatgggatctgcactgatgattgaaacagcaagaaaccccacatgtcctaaggtagctgctgtaagtaccatagtaaatagagggataacacccaaagcttttgtgttcagaaactatggtcattttcctggaatcaactctcattatttgggaggctgtcagtataaaatgtggcaggccattagagcctcatctgctgctccaggctactttgcagaatatgcattgggaaatgatcttcatcaagatggaggtttgcttctgaataacccttcggcattagctatgcatgagtgtaaatgtctttggccagatgtgccgttagagtgcatagtatccctgggcactggacgttatgagagtgatgtgagaaacacggtaacatacacaagcttgaaaactaaactttctaatgttatcaacagtgctacagatacagaagaagtccatataatgcttgatggcctgttacctcctgacacctattttagattcaatcctgtaatgtgtgaaaacatacctctagatgaaagtcgaaatgaaaagctggatcagctgcagttggaagggttgaaatacatagaaagaaatgaacaaaaaatgaaaaaagttgcaaaaatattaagtcaagaaaaaacaactctgcagaaaattaatgattggataaaattaaaaactgatatgtatgaaggacttccattcttttcaaaattgtga

Sequence Length

2349

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

34190006

NCBI GeneID

50640

Molecular Weight

77,031 Da

NCBI Official Full Name

Homo sapiens patatin-like phospholipase domain containing 8, mRNA

NCBI Official Synonym Full Names

patatin like phospholipase domain containing 8

NCBI Official Symbol

PNPLA8

NCBI Official Synonym Symbols

MMLA; IPLA2G; IPLA2-2; iPLA2gamma; PNPLA-gamma

NCBI Protein Information

calcium-independent phospholipase A2-gamma

UniProt Protein Name

Calcium-independent phospholipase A2-gamma

Protein Family

Calcium-independent phospholipase

UniProt Gene Name

PNPLA8

UniProt Synonym Gene Names

IPLA22; IPLA2G; iPLA2-gamma

UniProt Entry Name

PLPL8_HUMAN

NCBI Description

This gene encodes a member of the patatin-like phospholipase domain containing protein family. Members of this family are phospholipases which catalyze the cleavage of fatty acids from membrane phospholipids. The product of this gene is a calcium-independent phospholipase. Mutations in this gene have been associated with mitochondrial myopathy with lactic acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2015]

Uniprot Description

PNPLA8: Calcium-independent phospholipase A2, which catalyzes the hydrolysis of the sn-2 position of glycerophospholipids, PtdSer and to a lower extent PtdCho. Cleaves membrane phospholipids. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Phospholipase; Membrane protein, integral; Motility/polarity/chemotaxis; EC 3.1.1.5

Chromosomal Location of Human Ortholog: 7q31

Cellular Component: endoplasmic reticulum membrane; intracellular; membrane; peroxisomal membrane; peroxisome

Molecular Function: calcium-independent phospholipase A2 activity; phospholipase A2 activity

Biological Process: arachidonic acid metabolic process; arachidonic acid secretion; cell death; fatty acid metabolic process; linoleic acid metabolic process; phosphatidylethanolamine catabolic process; prostaglandin biosynthetic process

Disease: Mitochondrial Myopathy With Lactic Acidosis

Research Articles on PNPLA8

1. iPLA2gamma plays an important role in in vivo Thromboxane A2 production accompanied by thrombus formation.

Similar Products

Product Notes

The PNPLA8 pnpla8 (Catalog #AAA1277307) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctatta atctgactgt agatatatat atttacctcc ttagtaatgc aagaagtgtt tgtgggaagc agagaagcaa gcaactgtat ttcttgttct cacctaagca ttactggagg ataagccaca tcagtctaca aagaggtttt catacaaaca taataagatg taaatggacc aaaagtgaag cacattcttg cagtaagcac tgttactctc caagcaacca tggtttacat attgggattt tgaaacttag cacttctgct cccaagggac ttacaaaagt gaacatttgt atgtcccgta ttaaaagtac tttgaactct gtttcaaagg ctgtttttgg caatcaaaat gaaatgattt cacgtttagc tcaatttaag ccaagttccc aaattttaag aaaagtatcg gatagtggct ggttaaaaca gaaaaacatc aaacaagcca tcaaatctct gaaaaaatat agtgacaaat cagcagaaaa gagtcctttt ccagaagaga aaagtcacat tatagacaaa gaagaagata taggtaaacg cagtcttttt cattacacaa gttctataac cacaaaattt ggagactcat tctacttttt atcaaatcat attaattcat atttcaaacg taaggaaaaa atgtctcaac aaaaggaaaa tgaacatttc cgggacaaat cagaacttga agataaaaag gtagaagagg ggaaattaag atctccagat cctggcatcc tggcttataa gccaggctca gaatctgtac atacggtgga caagcctaca agtccttctg cgatacctga tgttcttcaa gtttcaacta aacaaagtat tgctaacttt ctttctcgtc ccacggaagg tgtacaagct ttagtaggtg gttatattgg tggacttgtc cccaaattaa agtatgattc aaagagtcag tcagaagaac aggaagagcc tgctaaaact gatcaggctg tcagcaaaga cagaaatgca gaggagaaaa agcgtttatc tcttcagcga gaaaagatta tcgcaagggt gagtattgat aacaggaccc gggcattagt tcaggcatta agaagaacaa ctgacccaaa gctctgcatt actagggttg aagaactgac ttttcatctt ctagaatttc ctgaaggaaa aggagtggct gtcaaggaaa gaattattcc atatttatta cgactgagac aaattaagga tgaaactctt caggctgcag ttagagaaat tttggcccta attggctatg tggatccagt gaaagggaga ggaatccgaa ttctctcaat tgatggtgga ggaacaaggg gcgtggttgc tctccagacc ctacgaaaat tagttgaact tactcagaag ccagttcatc agctctttga ttacatttgt ggtgtaagca caggtgccat attagctttc atgttggggt tgtttcatat gcccttggat gaatgtgagg aactttatcg aaaattagga tcagatgtat tttcacaaaa tgtcattgtt ggaacagtaa aaatgagttg gagccatgca ttttatgaca gtcaaacatg ggaaaacatt cttaaggata ggatgggatc tgcactgatg attgaaacag caagaaaccc cacatgtcct aaggtagctg ctgtaagtac catagtaaat agagggataa cacccaaagc ttttgtgttc agaaactatg gtcattttcc tggaatcaac tctcattatt tgggaggctg tcagtataaa atgtggcagg ccattagagc ctcatctgct gctccaggct actttgcaga atatgcattg ggaaatgatc ttcatcaaga tggaggtttg cttctgaata acccttcggc attagctatg catgagtgta aatgtctttg gccagatgtg ccgttagagt gcatagtatc cctgggcact ggacgttatg agagtgatgt gagaaacacg gtaacataca caagcttgaa aactaaactt tctaatgtta tcaacagtgc tacagataca gaagaagtcc atataatgct tgatggcctg ttacctcctg acacctattt tagattcaat cctgtaatgt gtgaaaacat acctctagat gaaagtcgaa atgaaaagct ggatcagctg cagttggaag ggttgaaata catagaaaga aatgaacaaa aaatgaaaaa agttgcaaaa atattaagtc aagaaaaaac aactctgcag aaaattaatg attggataaa attaaaaact gatatgtatg aaggacttcc attcttttca aaattgtga. It is sometimes possible for the material contained within the vial of "PNPLA8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

PNPLA8 cdna clone