Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PMVK cdna clone

PMVK cDNA Clone

Gene Names
PMVK; PMK; PMKA; PMKASE; POROK1; HUMPMKI
Synonyms
PMVK; PMVK cDNA Clone; PMVK cdna clone
Ordering
For Research Use Only!
Sequence
atggccccgctgggaggcgccccgcggctggtactgctgttcagcggcaagaggaaatccgggaaggacttcgtgaccgaggcgctgcagagcagacttggagctgatgtctgtgctgtcctccggctctctggtccactcaaggaacagtatgctcaggagcatggcttgaacttccagagactcctggacaccagcacctacaaggaggcctttcggaaggacatgatccgctggggagaggagaaacgccaggctgacccaggcttcttttgcaggaagattgtggagggcatctcccagcccatctggctggtgagtgacacacggagagtgtctgacatccagtggtttcgggaggcctatggggccgtgacgcagacggtccgcgttgtagcgttggagcagagccgacagcagcggggctgggtgttcacgccaggggtggacgatgctgagtcagaatgtggcctggacaacttcggggactttgactgggtcatcgagaaccatggagttgaacagcgcctggaggagcagttggagaacctgatagaatttatccgctccagactttag
Sequence Length
579
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,995 Da
NCBI Official Full Name
Homo sapiens phosphomevalonate kinase, mRNA
NCBI Official Synonym Full Names
phosphomevalonate kinase
NCBI Official Symbol
PMVK
NCBI Official Synonym Symbols
PMK; PMKA; PMKASE; POROK1; HUMPMKI
NCBI Protein Information
phosphomevalonate kinase
UniProt Protein Name
Phosphomevalonate kinase
UniProt Gene Name
PMVK
UniProt Synonym Gene Names
PMKI; PMKase; hPMK
UniProt Entry Name
PMVK_HUMAN

NCBI Description

This gene encodes a peroxisomal enzyme that catalyzes the conversion of mevalonate 5-phosphate into mevalonate 5-diphosphate, the fifth reaction of the cholesterol biosynthetic pathway. Studies in rat show that the message level and the enzyme activity of this protein is regulated by sterol, and that this regulation is coordinated with 3-hydroxy-3-methylglutaryl coenzyme A reductase, the rate-limiting enzyme of cholesterol biosynthesis. [provided by RefSeq, Sep 2011]

Uniprot Description

PMVK: Induced by sterol. Monomer.

Protein type: Kinase, other; EC 2.7.4.2; Secondary Metabolites Metabolism - terpenoid backbone biosynthesis

Chromosomal Location of Human Ortholog: 1q22

Cellular Component: cytosol; membrane; peroxisome

Molecular Function: ATP binding; phosphomevalonate kinase activity

Biological Process: cholesterol biosynthetic process; isopentenyl diphosphate biosynthetic process, mevalonate pathway; sterol biosynthetic process

Disease: Porokeratosis 1, Multiple Types

Research Articles on PMVK

Similar Products

Product Notes

The PMVK pmvk (Catalog #AAA1278498) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccccgc tgggaggcgc cccgcggctg gtactgctgt tcagcggcaa gaggaaatcc gggaaggact tcgtgaccga ggcgctgcag agcagacttg gagctgatgt ctgtgctgtc ctccggctct ctggtccact caaggaacag tatgctcagg agcatggctt gaacttccag agactcctgg acaccagcac ctacaaggag gcctttcgga aggacatgat ccgctgggga gaggagaaac gccaggctga cccaggcttc ttttgcagga agattgtgga gggcatctcc cagcccatct ggctggtgag tgacacacgg agagtgtctg acatccagtg gtttcgggag gcctatgggg ccgtgacgca gacggtccgc gttgtagcgt tggagcagag ccgacagcag cggggctggg tgttcacgcc aggggtggac gatgctgagt cagaatgtgg cctggacaac ttcggggact ttgactgggt catcgagaac catggagttg aacagcgcct ggaggagcag ttggagaacc tgatagaatt tatccgctcc agactttag. It is sometimes possible for the material contained within the vial of "PMVK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.