Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PLEKHO1 cdna clone

PLEKHO1 cDNA Clone

Gene Names
PLEKHO1; JBP; CKIP1; OC120; CKIP-1
Synonyms
PLEKHO1; PLEKHO1 cDNA Clone; PLEKHO1 cdna clone
Ordering
For Research Use Only!
Sequence
atgatgaagaagaacaattccgccaagcggggacctcaggatggaaaccagcagcctgcaccgcccgagaaggtcggctgggtccggaaattctgcgggaaagggattttcagggagatttggaaaaaccgctatgtggtgctgaaaggggaccagctctacatctctgagaaggaggtaaaagatgagaaaaatattcaagaggtatttgacctgagtgactatgagaagtgtgaagagctccggaagtccaagagcaggagcaagaaaaatcatagcaagtttactcttgcccactccaaacagcccggtaacacggcacccaacctgatcttcctggcagtgagtccagaagagaaggaatcgtggatcaatgccctcaactctgccatcacccgagccaagaaccgtatcttggatgaggtcaccgttgaggaggacagctatcttgcccatcccactcgagacagggcaaaaatccagcactcccgccgccccccaacaaggggacacctaatggctgtggcttccacctctacctcggatgggatgctgaccttggacttgatccaagaggaagacccttcccctgaggaaccaacctcttgtgctgagagctttcgggttgacctggacaagtctgtggcccagctggcagggagccggcggagagcggactcagaccgcatccagccctccgcagaccgggcaagcagtctctcccgaccttgggaaaaaacagacaaaggggccacctacaccccccaggcacccaagaagttgacgcccacagagaaaggccgctgcgcctccctggaggagatcctatctcagcgggatgctgcctctgcccgcaccctccagctgcgggctgaggaacccccaacccctgccctccccaacccggggcagctgtcccggatccaggacctggtagcaaggaaactggaggagactcaggagcttctggcagaggttcagggactgggagatgggaagcgaaaggccaaggacccccctcggtctccgccggattctgagtcagagcagctgctgctggagacggaacggctgctgggagaggcatcatcgaattggagccaggcaaagagggtgctgcaggaggtcagggagctgagagacctgtacagacagatggacctgcagaccccggactcccacctcagacagaccaccccgcacagtcagtaccggaagagcctgatgtga
Sequence Length
1230
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,330 Da
NCBI Official Full Name
Homo sapiens pleckstrin homology domain containing, family O member 1, mRNA
NCBI Official Synonym Full Names
pleckstrin homology domain containing O1
NCBI Official Symbol
PLEKHO1
NCBI Official Synonym Symbols
JBP; CKIP1; OC120; CKIP-1
NCBI Protein Information
pleckstrin homology domain-containing family O member 1
UniProt Protein Name
Pleckstrin homology domain-containing family O member 1
UniProt Gene Name
PLEKHO1
UniProt Synonym Gene Names
CKIP1; OC120; PH domain-containing family O member 1; JBP; CK2-interacting protein 1; CKIP-1
UniProt Entry Name
PKHO1_HUMAN

Uniprot Description

PLEKHO1: Plays a role in the regulation of the actin cytoskeleton through its interactions with actin capping protein (CP). May function to target CK2 to the plasma membrane thereby serving as an adapter to facilitate the phosphorylation of CP by protein kinase 2 (CK2). Appears to target ATM to the plasma membrane. Appears to also inhibit tumor cell growth by inhibiting AKT- mediated cell-survival. Also implicated in PI3K-regulated muscle differentiation, the regulation of AP-1 activity (plasma membrane bound AP-1 regulator that translocates to the nucleus) and the promotion of apoptosis induced by tumor necrosis factor TNF. When bound to PKB, it inhibits it probably by decreasing PKB level of phosphorylation. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold; Tumor suppressor

Chromosomal Location of Human Ortholog: 1q21.2

Molecular Function: protein binding

Research Articles on PLEKHO1

Similar Products

Product Notes

The PLEKHO1 plekho1 (Catalog #AAA1270409) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgaaga agaacaattc cgccaagcgg ggacctcagg atggaaacca gcagcctgca ccgcccgaga aggtcggctg ggtccggaaa ttctgcggga aagggatttt cagggagatt tggaaaaacc gctatgtggt gctgaaaggg gaccagctct acatctctga gaaggaggta aaagatgaga aaaatattca agaggtattt gacctgagtg actatgagaa gtgtgaagag ctccggaagt ccaagagcag gagcaagaaa aatcatagca agtttactct tgcccactcc aaacagcccg gtaacacggc acccaacctg atcttcctgg cagtgagtcc agaagagaag gaatcgtgga tcaatgccct caactctgcc atcacccgag ccaagaaccg tatcttggat gaggtcaccg ttgaggagga cagctatctt gcccatccca ctcgagacag ggcaaaaatc cagcactccc gccgcccccc aacaagggga cacctaatgg ctgtggcttc cacctctacc tcggatggga tgctgacctt ggacttgatc caagaggaag acccttcccc tgaggaacca acctcttgtg ctgagagctt tcgggttgac ctggacaagt ctgtggccca gctggcaggg agccggcgga gagcggactc agaccgcatc cagccctccg cagaccgggc aagcagtctc tcccgacctt gggaaaaaac agacaaaggg gccacctaca ccccccaggc acccaagaag ttgacgccca cagagaaagg ccgctgcgcc tccctggagg agatcctatc tcagcgggat gctgcctctg cccgcaccct ccagctgcgg gctgaggaac ccccaacccc tgccctcccc aacccggggc agctgtcccg gatccaggac ctggtagcaa ggaaactgga ggagactcag gagcttctgg cagaggttca gggactggga gatgggaagc gaaaggccaa ggacccccct cggtctccgc cggattctga gtcagagcag ctgctgctgg agacggaacg gctgctggga gaggcatcat cgaattggag ccaggcaaag agggtgctgc aggaggtcag ggagctgaga gacctgtaca gacagatgga cctgcagacc ccggactccc acctcagaca gaccaccccg cacagtcagt accggaagag cctgatgtga. It is sometimes possible for the material contained within the vial of "PLEKHO1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.