Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PKIA cdna clone

PKIA cDNA Clone

Gene Names
PKIA; PRKACN1
Synonyms
PKIA; PKIA cDNA Clone; PKIA cdna clone
Ordering
For Research Use Only!
Sequence
atgactgatgtggaaactacatatgcagattttattgcttcaggaagaacaggtagaagaaatgcaatacatgatatcctggtttcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagacagaaggtgaagaagatgcacaacgaagttctacagaacaaagtggggaagcccagggagaagcagcaaaatctgaaagctaa
Sequence Length
231
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
7,989 Da
NCBI Official Full Name
Homo sapiens protein kinase (cAMP-dependent, catalytic) inhibitor alpha, mRNA
NCBI Official Synonym Full Names
protein kinase (cAMP-dependent, catalytic) inhibitor alpha
NCBI Official Symbol
PKIA
NCBI Official Synonym Symbols
PRKACN1
NCBI Protein Information
cAMP-dependent protein kinase inhibitor alpha
UniProt Protein Name
cAMP-dependent protein kinase inhibitor alpha
Protein Family
UniProt Gene Name
PKIA
UniProt Synonym Gene Names
PRKACN1; PKI-alpha
UniProt Entry Name
IPKA_HUMAN

NCBI Description

The protein encoded by this gene is a member of the cAMP-dependent protein kinase (PKA) inhibitor family. This protein was demonstrated to interact with and inhibit the activities of both C alpha and C beta catalytic subunits of the PKA. Alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]

Uniprot Description

PKIA: Extremely potent competitive inhibitor of cAMP-dependent protein kinase activity, this protein interacts with the catalytic subunit of the enzyme after the cAMP-induced dissociation of its regulatory chains. Belongs to the PKI family.

Protein type: Inhibitor

Chromosomal Location of Human Ortholog: 8q21.12

Cellular Component: cytoplasm; nucleus

Molecular Function: cAMP-dependent protein kinase inhibitor activity; protein binding

Research Articles on PKIA

Similar Products

Product Notes

The PKIA pkia (Catalog #AAA1272301) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactgatg tggaaactac atatgcagat tttattgctt caggaagaac aggtagaaga aatgcaatac atgatatcct ggtttcctct gcaagtggca acagcaatga attagccttg aaattagcag gtcttgatat caacaagaca gaaggtgaag aagatgcaca acgaagttct acagaacaaa gtggggaagc ccagggagaa gcagcaaaat ctgaaagcta a. It is sometimes possible for the material contained within the vial of "PKIA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.