Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PJA2 cdna clone

PJA2 cDNA Clone

Gene Names
PJA2; RNF131; Neurodap1
Synonyms
PJA2; PJA2 cDNA Clone; PJA2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcacagtacactgaaaaggagccagcagcaatggaccaagaatctggtaaggctgtctggcccaaaccagcaggagggtatcagacaattacaggcaggagatatggaagaagacatgcttatgtcagttttaaaccatgtatgaccagacatgaaagaagcttaggtcgggctggtgatgactatgaagtgttggaactagatgatgttccaaaggaaaattcctcaggttccagtcctttggatcaagttgattcttctttaccaagtgaacctatatttgaaaaaagtgaaacagaaattcccacttgtggttcagcattgaatcaaaccactgagagcagtcaatcctttgttgcagtacatcacagtgaggaaggcagggataccttaggaagcagtacaaatcttcataatcactctgagggagagtatattccaggagcttgtagtgcttcaagtgtccaaaatggaattgcattggttcatacagactcttatgatccagatggcaaacatggagaagataatgaccatcttcaactttctgcagaagtcgtggaaggtagtagataccaggaatcattaggcaatacagtatttgagttggaaaacagagaggcagaggcatacactggtctttcaccaccagttccctcatttaactgtgaagtaagagatgagtttgaagagttagattctgtaccattagtgaaaagttctgctggtgatactgagtttgtccatcagaatagccaggaaattcagaggtcttctcaagatgaaatggttagtacgaaacaacaaaataatactagccaggaaagacagacagaacattcacctgaagatgcagcctgtggtccagggcatatttgtagtgaacgaaataccaatgatagggaaaagaaccatggaagttctcctgaacaggtagtgaggccaaaagttagaaaactgataagttcaagccaggtggaccaagaaacaggttttaataggcatgaggcgaaacaaagaagtgttcaaagatggagagaggctttggaagttgaggaaagtggctcagatgacctcttaataaaatgtgaagaatatgatggagagcatgactgtatgttcttggatccaccatactcaagagttattacacaaagggaaacagaaaataaccaaatgacatcagaaagtggagccacagcgggaaggcaagaagtggataacaccttttggaatggctgtggagattattaccaactctatgacaaagatgaagatagttctgaatgcagtgatggggaatggtctgcttctttgcctcatcgattttctggtacagaaaaagatcaatcctcaagtgatgaaagctgggagactctgccaggaaaagatgagaatgaacctgagctacaaagtgatagcagtggccctgaagaagaaaaccaagaattatctcttcaggaaggggaacagacatccttggaagagggagaaattccttggttacagtacaatgaagtcaatgaaagcagcagtgatgagggaaatgaacctgccaatgaatttgcacagccagctttcatgttggatggtaacaataacctggaggatgactccagtgtgagtgaagacttagatgtggattggagcatatttgatggctttgcagatggactaggagttgctgaagctatttcatatgtggatcctcagttccttacatacatggcactagaagaacgcttagcccaggctatggagactgctctggcccatttagagtctcttgcagtggatgttgaggtggccaatccaccagctagtaaggaaagcattgatggtcttccagagacccttgttcttgaagatcacactgctattggtcaggaacaatgctgtccaatctgttgcagtgagtatattaaggatgatatagcaacagagttgccctgtcaccatttctttcacaaaccttgtgtctcaatttggctacaaaagtcgggaacatgccctgtgtgccgccgtcatttcccacctgcggttattgaagcatctgcagctccttcctctgagcctgatcctgatgccccaccttcgaatgacagtattgcagaagcaccctaa
Sequence Length
2127
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
76,091 Da
NCBI Official Full Name
Homo sapiens praja ring finger 2, mRNA
NCBI Official Synonym Full Names
praja ring finger ubiquitin ligase 2
NCBI Official Symbol
PJA2
NCBI Official Synonym Symbols
RNF131; Neurodap1
NCBI Protein Information
E3 ubiquitin-protein ligase Praja-2
UniProt Protein Name
E3 ubiquitin-protein ligase Praja-2
UniProt Gene Name
PJA2
UniProt Synonym Gene Names
KIAA0438; RNF131; Praja2
UniProt Entry Name
PJA2_HUMAN

Uniprot Description

PJA2: Has E2-dependent E3 ubiquitin-protein ligase activity. Responsible for ubiquitination of cAMP-dependent protein kinase type I and type II-alpha/beta regulatory subunits and for targeting them for proteasomal degradation. Essential for PKA- mediated long-term memory processes. Binds ubiquitin-conjugating enzymes (E2s). In vitro, interacts with the ubiquitin-conjugating enzyme, UBE2D2. The phosphorylated form interacts with PRKAR1A, PRKAR2A and PRKAR2B. Binds the catalytic subunits of cAMP-dependent protein kinase. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin ligase; Ubiquitin conjugating system; Ligase; EC 6.3.2.-; EC 6.3.2.19

Chromosomal Location of Human Ortholog: 5q21.3

Cellular Component: cytoplasm; intermediate filament cytoskeleton; plasma membrane

Molecular Function: ubiquitin-protein ligase activity

Biological Process: long-term memory; protein ubiquitination

Research Articles on PJA2

Similar Products

Product Notes

The PJA2 pja2 (Catalog #AAA1274383) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcacagt acactgaaaa ggagccagca gcaatggacc aagaatctgg taaggctgtc tggcccaaac cagcaggagg gtatcagaca attacaggca ggagatatgg aagaagacat gcttatgtca gttttaaacc atgtatgacc agacatgaaa gaagcttagg tcgggctggt gatgactatg aagtgttgga actagatgat gttccaaagg aaaattcctc aggttccagt cctttggatc aagttgattc ttctttacca agtgaaccta tatttgaaaa aagtgaaaca gaaattccca cttgtggttc agcattgaat caaaccactg agagcagtca atcctttgtt gcagtacatc acagtgagga aggcagggat accttaggaa gcagtacaaa tcttcataat cactctgagg gagagtatat tccaggagct tgtagtgctt caagtgtcca aaatggaatt gcattggttc atacagactc ttatgatcca gatggcaaac atggagaaga taatgaccat cttcaacttt ctgcagaagt cgtggaaggt agtagatacc aggaatcatt aggcaataca gtatttgagt tggaaaacag agaggcagag gcatacactg gtctttcacc accagttccc tcatttaact gtgaagtaag agatgagttt gaagagttag attctgtacc attagtgaaa agttctgctg gtgatactga gtttgtccat cagaatagcc aggaaattca gaggtcttct caagatgaaa tggttagtac gaaacaacaa aataatacta gccaggaaag acagacagaa cattcacctg aagatgcagc ctgtggtcca gggcatattt gtagtgaacg aaataccaat gatagggaaa agaaccatgg aagttctcct gaacaggtag tgaggccaaa agttagaaaa ctgataagtt caagccaggt ggaccaagaa acaggtttta ataggcatga ggcgaaacaa agaagtgttc aaagatggag agaggctttg gaagttgagg aaagtggctc agatgacctc ttaataaaat gtgaagaata tgatggagag catgactgta tgttcttgga tccaccatac tcaagagtta ttacacaaag ggaaacagaa aataaccaaa tgacatcaga aagtggagcc acagcgggaa ggcaagaagt ggataacacc ttttggaatg gctgtggaga ttattaccaa ctctatgaca aagatgaaga tagttctgaa tgcagtgatg gggaatggtc tgcttctttg cctcatcgat tttctggtac agaaaaagat caatcctcaa gtgatgaaag ctgggagact ctgccaggaa aagatgagaa tgaacctgag ctacaaagtg atagcagtgg ccctgaagaa gaaaaccaag aattatctct tcaggaaggg gaacagacat ccttggaaga gggagaaatt ccttggttac agtacaatga agtcaatgaa agcagcagtg atgagggaaa tgaacctgcc aatgaatttg cacagccagc tttcatgttg gatggtaaca ataacctgga ggatgactcc agtgtgagtg aagacttaga tgtggattgg agcatatttg atggctttgc agatggacta ggagttgctg aagctatttc atatgtggat cctcagttcc ttacatacat ggcactagaa gaacgcttag cccaggctat ggagactgct ctggcccatt tagagtctct tgcagtggat gttgaggtgg ccaatccacc agctagtaag gaaagcattg atggtcttcc agagaccctt gttcttgaag atcacactgc tattggtcag gaacaatgct gtccaatctg ttgcagtgag tatattaagg atgatatagc aacagagttg ccctgtcacc atttctttca caaaccttgt gtctcaattt ggctacaaaa gtcgggaaca tgccctgtgt gccgccgtca tttcccacct gcggttattg aagcatctgc agctccttcc tctgagcctg atcctgatgc cccaccttcg aatgacagta ttgcagaagc accctaa. It is sometimes possible for the material contained within the vial of "PJA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.