PIP5K1B cdna clone

PIP5K1B cDNA Clone

Gene Names

PIP5K1B; MSS4; STM7

Synonyms

PIP5K1B; PIP5K1B cDNA Clone; PIP5K1B cdna clone

Ordering
Cat. Num. AAA1267828 For Research Use Only!

Sequence

atgtcttctgctgctgaaaatggagaggcagcacctggaaaacaaaatgaagaaaaaacctataaaaagacacaagtgaaaaaccaaatcctgtctcgtttacccaagattccgtgtacattcattcaagcatggaccaacacagagatgattacgttgctagcctgttattacttcagatcagtttcaactgcatcatctgctattaaaggtgctattcagctgggaataggatacacagtgggtaatctcacttccaagccagaacgagatgttcttatgcaagacttttatgtggtggaaagtgtgttcctacccagcgaagggagcaatctgaccccagcacatcactacccagactttagatttaagacatacgctccattagcattccgatatttcagagaactttttggtatcaagcctgatgattacttgtattccatctgcagtgaacctctaatagaactgtctaaccctggagccagtggatccttgttttttgtgaccagtgatgatgaatttatcatcaaaacagttcagcacaaagaagctgagtttcttcagaagctactgccaggctattacatgaatttaaaccagaatccaaggactcttttgccaaaattttacggactgtattgtatgcaatcaggaggcattaatatcaggattgtggtgatgaacaacgttttgccacgctccatgagaatgcactttacatatgacttgaaaggctcaacgtataagcgaagagcatcccgtaaagagagagagaaatccaaccccacatttaaggacttagatttcctgcaagacatgcacgaagggttgtattttgatacggaaacatacaacgcgcttatgaaaacacttcagagagactgccgggtgctagaaagcttcaagatcatggattatagccttctgttgggaattcatttcctggaccattccctcaaagagaaagaggaggagaccccacaaaatgtgcctgatgctaagcggactgggatgcagaaggttctctactcaacagccatggaatctatccagggtccagggaaatctggagatgggataatcacagagaacccagacacaatgggaggcattccagctaaaagccataggggagaaaaactacttttatttacgggcattattgacattctgcaatcatataggttaatgaagaagttagaacattcctggaaagctcttgtttatgatggggacactgtttctgttcatagaccaagcttttatgcagacagatttcttaagttcatgaattccagagttttcaagaaaattcaagctttgaaggcttcaccgtctaagaaacggtgcaattcaatcgccgccctaaaggccacttcacaggagattgtgtcctcaattagccaggaatggaaggatgagaagcgggatttgctgactgaaggacaaagttttagcagccttgatgaagaagccctgggatcccgacacaggccagacctggtccctagcactccatcactgtttgaagctgcttccttggcaaccacaatttcatcttcttccttatacgtcaatgagcactatccacacgacaggcctacactctattcaaacaggttcaagatggcaacatcagagcattaa

Sequence Length

1650

Vector

pENTR223.1

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

34192156

NCBI GeneID

8395

Molecular Weight

56,951 Da

NCBI Official Full Name

Homo sapiens phosphatidylinositol-4-phosphate 5-kinase, type I, beta, mRNA

NCBI Official Synonym Full Names

phosphatidylinositol-4-phosphate 5-kinase type 1 beta

NCBI Official Symbol

PIP5K1B

NCBI Official Synonym Symbols

MSS4; STM7

NCBI Protein Information

phosphatidylinositol 4-phosphate 5-kinase type-1 beta

UniProt Protein Name

Phosphatidylinositol 4-phosphate 5-kinase type-1 beta

Protein Family

Phosphatidylinositol 4-phosphate 5-kinase

UniProt Gene Name

PIP5K1B

UniProt Synonym Gene Names

STM7; PIP5K1-beta; PtdIns(4)P-5-kinase 1 beta; PIP5KIbeta

UniProt Entry Name

PI51B_HUMAN

Uniprot Description

PIP5K1B: Participates in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. Mediates RAC1-dependent reorganization of actin filaments. Contributes to the activation of PLD2. Together with PIP5K1A is required after stimulation of G-protein coupled receptors for stable platelet adhesion. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 2.7.1.68; Kinase, lipid; Carbohydrate Metabolism - inositol phosphate

Chromosomal Location of Human Ortholog: 9q13

Cellular Component: cytosol; uropod

Molecular Function: 1-phosphatidylinositol-3-phosphate 5-kinase activity; 1-phosphatidylinositol-4-phosphate 5-kinase activity; protein binding

Biological Process: phosphatidylinositol biosynthetic process; regulation of phosphoinositide 3-kinase cascade

Research Articles on PIP5K1B

1. Data indicate that type I phosphatidylinositol 4-phosphate 5-kinase PIP5KIbeta mutants whose dimerization was impaired showed a severe decrease in PI(4,5)P2 production and plasma membrane delocalization.

Similar Products

Product Notes

The PIP5K1B pip5k1b (Catalog #AAA1267828) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcttctg ctgctgaaaa tggagaggca gcacctggaa aacaaaatga agaaaaaacc tataaaaaga cacaagtgaa aaaccaaatc ctgtctcgtt tacccaagat tccgtgtaca ttcattcaag catggaccaa cacagagatg attacgttgc tagcctgtta ttacttcaga tcagtttcaa ctgcatcatc tgctattaaa ggtgctattc agctgggaat aggatacaca gtgggtaatc tcacttccaa gccagaacga gatgttctta tgcaagactt ttatgtggtg gaaagtgtgt tcctacccag cgaagggagc aatctgaccc cagcacatca ctacccagac tttagattta agacatacgc tccattagca ttccgatatt tcagagaact ttttggtatc aagcctgatg attacttgta ttccatctgc agtgaacctc taatagaact gtctaaccct ggagccagtg gatccttgtt ttttgtgacc agtgatgatg aatttatcat caaaacagtt cagcacaaag aagctgagtt tcttcagaag ctactgccag gctattacat gaatttaaac cagaatccaa ggactctttt gccaaaattt tacggactgt attgtatgca atcaggaggc attaatatca ggattgtggt gatgaacaac gttttgccac gctccatgag aatgcacttt acatatgact tgaaaggctc aacgtataag cgaagagcat cccgtaaaga gagagagaaa tccaacccca catttaagga cttagatttc ctgcaagaca tgcacgaagg gttgtatttt gatacggaaa catacaacgc gcttatgaaa acacttcaga gagactgccg ggtgctagaa agcttcaaga tcatggatta tagccttctg ttgggaattc atttcctgga ccattccctc aaagagaaag aggaggagac cccacaaaat gtgcctgatg ctaagcggac tgggatgcag aaggttctct actcaacagc catggaatct atccagggtc cagggaaatc tggagatggg ataatcacag agaacccaga cacaatggga ggcattccag ctaaaagcca taggggagaa aaactacttt tatttacggg cattattgac attctgcaat catataggtt aatgaagaag ttagaacatt cctggaaagc tcttgtttat gatggggaca ctgtttctgt tcatagacca agcttttatg cagacagatt tcttaagttc atgaattcca gagttttcaa gaaaattcaa gctttgaagg cttcaccgtc taagaaacgg tgcaattcaa tcgccgccct aaaggccact tcacaggaga ttgtgtcctc aattagccag gaatggaagg atgagaagcg ggatttgctg actgaaggac aaagttttag cagccttgat gaagaagccc tgggatcccg acacaggcca gacctggtcc ctagcactcc atcactgttt gaagctgctt ccttggcaac cacaatttca tcttcttcct tatacgtcaa tgagcactat ccacacgaca ggcctacact ctattcaaac aggttcaaga tggcaacatc agagcattaa. It is sometimes possible for the material contained within the vial of "PIP5K1B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

PIP5K1B cdna clone