PIGN cdna clone
PIGN cDNA Clone
Gene Names
PIGN; MCD4; MDC4; MCAHS; PIG-N; MCAHS1
Synonyms
PIGN; PIGN cDNA Clone; PIGN cdna clone
Sequence
atgctgctgttctttactttgggattgcttatacattttgtgttcttcgcctccatctttgacatttattttacatctcctttggttcatggaatgactcctcagtttacaccattgcctcctccagcgagaagattagtgttgtttgttgctgatggccttcgagcagatgcactttacgaattagatgaaaatggaaactctagagcaccgtttattaggaatatcataatgcatgaaggcagctggggcatatctcatacacgtgtgccaacagaatctcggccaggtcatgtagctctgatagctgggttttatgaagatgtcagtgcagttgccaaaggatggaaggaaaatcctgtagagtttgattctctttttaatgaaagtaaatacacatggagctggggaagcccagatatcctgcctatgtttgccaaaggtgctagtggagaccacgtttatacatatagttatgatgctaaaagagaggattttggtgctcaagatgcaacaaaactggatacgtgggtttttgataatgttaaggacttctttcatcatgccagaaacaaccagtctttgttttctaaaataaatgaagagaaaatagtttttttcttacatttattaggaatagatacaaacggacatgctcatcgaccatcctcgagagactacaaggacaatattaaaaaagttgatgatggagttaaagaaatcgtgtctatgtttaaccatttctatggaaatgatgggaaaacaacatttatctttacctctgaccatggaatgacagactggggttcccatggggctggtcatccttcagagactttaactcctttagtcacttggggagctggaatcaagtatccccaaagagtatcagctcagcaatttgatgatgcatttttgaaagagtggagattggagaattggaagaggctagatgtcaatcaggctgatattgcaccattgatgacttcccttattggagttccctttcctcttaactcagtgggaatccttcctgtggattatcttaacaacactgatctcttcaaagcagagagcatgtttacaaatgcagtacagattcttgaacagttcaaggtgaaaatgactcagaagaaagaagttactttaccatttttgtttacaccatttaaactgctttctgattccaaacagttcaacattttaagaaaagcaagatcttatataaaacacagaaagtttgatgaagtggtctccctttgcaaggagctaattcatcttgcattgaaaggattgtcctattatcacacatatgacagattctttttgggcgtcaatgttgttattggttttgtgggatggatatcttatgcctctttgttgatcatcaagtctcattccaaccttataaaaggtgttagtaaagaagtgaagaaaccaagccatctcctgccttgtagttttgtagctattggcattttagtagcattttttctgctgattcaagcctgtccctggacatattatgtatatggtttgttgccactgccaatatggtatgcggttctaagagaatttcaagttattcaggaccttgttgtatcagtgttgacctatcctctgagccattttgttgggtacctgttagcctttaccctgggaattgaagtattagttctcagttttttctaccgctatatgcttaccgctggacttactgcctttgcagcttggccatttctcactcggctgtggactcgagcaaagatgacctcactgagttggactttcttctctttgctcctggcagtgttcccactgatgccggttgtaggtcgaaagccagacatctctctagtgatgggtgcaggcttgctggttcttctgttatccctgtgtgttgtaacatctctcatgaaaagaaaagatagctttataaaggaagagctattggtacatctgttacaggtgctgagcacagtgctctccatgtatgttgtgtatagcactcagagtagtctactcaggaagcaaggactgcctctcatgaatcaaattattagctgggcaacattagcctcttccttggttgtgccactactgagttctccagttctctttcagcgattgttcagcatacttctttcattgatgtcaacctacctacttctaagcacagggtatgaagctctctttccactagtgttgtcttgtttgatgtttgtctggataaacatagaacaagaaactctacaacaatctggtgtttgctgtaaacaaaagctcaccagtatccagttctcttataatactgatataactcagtttcgacagctatatctggatgacatccgtagggcctttttccttgttttcttcttagtgacagcattttttggaactggaaatatagcttctattaacagctttgatcttgcctctgtctattgctttctgactgtgttcagtccttttatgatgggagccctgatgatgtggaagattttaatcccctttgttcttgttatgtgtgcttttgaagcagttcagttgactactcagttatcgtcaaaaagcctttttctcattgttctcgtcatatcagacattatggctttgcattttttcttcttggtcaaggattatggcagctggcttgatattgggacaagcatcagccactatgtgattgtcatgtccatgaccatctttttggtgttcctcaatggcctggcccagctgctcacaacgaagaaactcagactatgtggcaaacccaaaagtcacttcatgtga
Sequence Length
2796
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
105,810 Da
NCBI Official Full Name
Homo sapiens phosphatidylinositol glycan anchor biosynthesis, class N, mRNA
NCBI Official Synonym Full Names
phosphatidylinositol glycan anchor biosynthesis class N
NCBI Official Symbol
PIGN
NCBI Official Synonym Symbols
MCD4; MDC4; MCAHS; PIG-N; MCAHS1
NCBI Protein Information
GPI ethanolamine phosphate transferase 1
UniProt Protein Name
GPI ethanolamine phosphate transferase 1
UniProt Gene Name
PIGN
UniProt Synonym Gene Names
MCD4; PIG-N
UniProt Entry Name
PIGN_HUMAN
NCBI Description
This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is expressed in the endoplasmic reticulum and transfers phosphoethanolamine (EtNP) to the first mannose of the GPI anchor. Two alternatively spliced variants, which encode an identical isoform, have been reported. [provided by RefSeq, Jul 2008]
Uniprot Description
PIGN: Ethanolamine phosphate transferase involved in glycosylphosphatidylinositol-anchor biosynthesis. Transfers ethanolamine phosphate to the first alpha-1,4-linked mannose of the glycosylphosphatidylinositol precursor of GPI-anchor. Defects in PIGN are the cause of multiple congenital anomalies-hypotonia-seizures syndrome type 1 (MCAHS1). An autosomal recessive disorder characterized by neonatal hypotonia, lack of psychomotor development, seizures, dysmorphic features, and variable congenital anomalies involving the cardiac, urinary, and gastrointestinal systems. Most affected individuals die before 3 years of age. Belongs to the PIGG/PIGN/PIGO family. PIGN subfamily.
Protein type: Membrane protein, integral; Endoplasmic reticulum; Glycan Metabolism - glycosylphosphatidylinositol (GPI)-anchor biosynthesis; EC 2.-.-.-; Transferase; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 18q21.33
Cellular Component: endoplasmic reticulum membrane; membrane
Molecular Function: mannose-ethanolamine phosphotransferase activity; phosphotransferase activity, for other substituted phosphate groups
Biological Process: GPI anchor biosynthetic process; preassembly of GPI anchor in ER membrane
Disease: Multiple Congenital Anomalies-hypotonia-seizures Syndrome 1
Research Articles on PIGN
Similar Products
Product Notes
The PIGN pign (Catalog #AAA1277080) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgctgt tctttacttt gggattgctt atacattttg tgttcttcgc ctccatcttt gacatttatt ttacatctcc tttggttcat ggaatgactc ctcagtttac accattgcct cctccagcga gaagattagt gttgtttgtt gctgatggcc ttcgagcaga tgcactttac gaattagatg aaaatggaaa ctctagagca ccgtttatta ggaatatcat aatgcatgaa ggcagctggg gcatatctca tacacgtgtg ccaacagaat ctcggccagg tcatgtagct ctgatagctg ggttttatga agatgtcagt gcagttgcca aaggatggaa ggaaaatcct gtagagtttg attctctttt taatgaaagt aaatacacat ggagctgggg aagcccagat atcctgccta tgtttgccaa aggtgctagt ggagaccacg tttatacata tagttatgat gctaaaagag aggattttgg tgctcaagat gcaacaaaac tggatacgtg ggtttttgat aatgttaagg acttctttca tcatgccaga aacaaccagt ctttgttttc taaaataaat gaagagaaaa tagttttttt cttacattta ttaggaatag atacaaacgg acatgctcat cgaccatcct cgagagacta caaggacaat attaaaaaag ttgatgatgg agttaaagaa atcgtgtcta tgtttaacca tttctatgga aatgatggga aaacaacatt tatctttacc tctgaccatg gaatgacaga ctggggttcc catggggctg gtcatccttc agagacttta actcctttag tcacttgggg agctggaatc aagtatcccc aaagagtatc agctcagcaa tttgatgatg catttttgaa agagtggaga ttggagaatt ggaagaggct agatgtcaat caggctgata ttgcaccatt gatgacttcc cttattggag ttccctttcc tcttaactca gtgggaatcc ttcctgtgga ttatcttaac aacactgatc tcttcaaagc agagagcatg tttacaaatg cagtacagat tcttgaacag ttcaaggtga aaatgactca gaagaaagaa gttactttac catttttgtt tacaccattt aaactgcttt ctgattccaa acagttcaac attttaagaa aagcaagatc ttatataaaa cacagaaagt ttgatgaagt ggtctccctt tgcaaggagc taattcatct tgcattgaaa ggattgtcct attatcacac atatgacaga ttctttttgg gcgtcaatgt tgttattggt tttgtgggat ggatatctta tgcctctttg ttgatcatca agtctcattc caaccttata aaaggtgtta gtaaagaagt gaagaaacca agccatctcc tgccttgtag ttttgtagct attggcattt tagtagcatt ttttctgctg attcaagcct gtccctggac atattatgta tatggtttgt tgccactgcc aatatggtat gcggttctaa gagaatttca agttattcag gaccttgttg tatcagtgtt gacctatcct ctgagccatt ttgttgggta cctgttagcc tttaccctgg gaattgaagt attagttctc agttttttct accgctatat gcttaccgct ggacttactg cctttgcagc ttggccattt ctcactcggc tgtggactcg agcaaagatg acctcactga gttggacttt cttctctttg ctcctggcag tgttcccact gatgccggtt gtaggtcgaa agccagacat ctctctagtg atgggtgcag gcttgctggt tcttctgtta tccctgtgtg ttgtaacatc tctcatgaaa agaaaagata gctttataaa ggaagagcta ttggtacatc tgttacaggt gctgagcaca gtgctctcca tgtatgttgt gtatagcact cagagtagtc tactcaggaa gcaaggactg cctctcatga atcaaattat tagctgggca acattagcct cttccttggt tgtgccacta ctgagttctc cagttctctt tcagcgattg ttcagcatac ttctttcatt gatgtcaacc tacctacttc taagcacagg gtatgaagct ctctttccac tagtgttgtc ttgtttgatg tttgtctgga taaacataga acaagaaact ctacaacaat ctggtgtttg ctgtaaacaa aagctcacca gtatccagtt ctcttataat actgatataa ctcagtttcg acagctatat ctggatgaca tccgtagggc ctttttcctt gttttcttct tagtgacagc attttttgga actggaaata tagcttctat taacagcttt gatcttgcct ctgtctattg ctttctgact gtgttcagtc cttttatgat gggagccctg atgatgtgga agattttaat cccctttgtt cttgttatgt gtgcttttga agcagttcag ttgactactc agttatcgtc aaaaagcctt tttctcattg ttctcgtcat atcagacatt atggctttgc attttttctt cttggtcaag gattatggca gctggcttga tattgggaca agcatcagcc actatgtgat tgtcatgtcc atgaccatct ttttggtgtt cctcaatggc ctggcccagc tgctcacaac gaagaaactc agactatgtg gcaaacccaa aagtcacttc atgtga. It is sometimes possible for the material contained within the vial of "PIGN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
