Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PIGH cdna clone

PIGH cDNA Clone

Gene Names
PIGH; GPI-H
Synonyms
PIGH; PIGH cDNA Clone; PIGH cdna clone
Ordering
For Research Use Only!
Sequence
atggaggatgagcggagcttttcggatatctgcggcggccgcctggcgctgcagcgccgctactactccccgtcctgccgggaattctgcctcagctgccctcggctctcgctgcgttcgctcaccgctgtcacctgcacggtgtggctggcggcctacggactcttcaccctctgcgagaacagcatgatcctctctgctgccatcttcatcaccctcttaggtctgcttggttatctccattttgtgaagattgatcaggagactctgttaatcattgattcccttggcattcagatgacttcatcttatgcttcaggcaaagaaagcactaccttcatagaaatgggcaaggtcaaggatattgtcatcaatgaggccatttacatgcagaaggtgatttactacctctgcatcttattgaaagatccagtggaaccacatgggatatcccaagtagtacccgtcttccagagtgccaagccccggctggactgcttgattgaagtatacaggagctgccaggagatcctggcacaccagaaagccacatcaacaagcccatga
Sequence Length
567
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,081 Da
NCBI Official Full Name
Homo sapiens phosphatidylinositol glycan anchor biosynthesis, class H, mRNA
NCBI Official Synonym Full Names
phosphatidylinositol glycan anchor biosynthesis class H
NCBI Official Symbol
PIGH
NCBI Official Synonym Symbols
GPI-H
NCBI Protein Information
phosphatidylinositol N-acetylglucosaminyltransferase subunit H
UniProt Protein Name
Phosphatidylinositol N-acetylglucosaminyltransferase subunit H
UniProt Gene Name
PIGH
UniProt Synonym Gene Names
PIG-H
UniProt Entry Name
PIGH_HUMAN

NCBI Description

This gene encodes an endoplasmic reticulum associated protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI anchor is a glycolipid found on many blood cells and which serves to anchor proteins to the cell surface. The protein encoded by this gene is a subunit of the GPI N-acetylglucosaminyl (GlcNAc) transferase that transfers GlcNAc to phosphatidylinositol (PI) on the cytoplasmic side of the endoplasmic reticulum. [provided by RefSeq, Jul 2008]

Uniprot Description

PIGH: Part of the complex catalyzing the transfer of N- acetylglucosamine from UDP-N-acetylglucosamine to phosphatidylinositol, the first step of GPI biosynthesis. Belongs to the PIGH family.

Protein type: Endoplasmic reticulum; EC 2.4.1.198; Transferase; Glycan Metabolism - glycosylphosphatidylinositol (GPI)-anchor biosynthesis

Chromosomal Location of Human Ortholog: 14q24.1

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex

Molecular Function: catalytic activity

Biological Process: GPI anchor biosynthetic process; preassembly of GPI anchor in ER membrane; protein modification process

Similar Products

Product Notes

The PIGH pigh (Catalog #AAA1269695) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggatg agcggagctt ttcggatatc tgcggcggcc gcctggcgct gcagcgccgc tactactccc cgtcctgccg ggaattctgc ctcagctgcc ctcggctctc gctgcgttcg ctcaccgctg tcacctgcac ggtgtggctg gcggcctacg gactcttcac cctctgcgag aacagcatga tcctctctgc tgccatcttc atcaccctct taggtctgct tggttatctc cattttgtga agattgatca ggagactctg ttaatcattg attcccttgg cattcagatg acttcatctt atgcttcagg caaagaaagc actaccttca tagaaatggg caaggtcaag gatattgtca tcaatgaggc catttacatg cagaaggtga tttactacct ctgcatctta ttgaaagatc cagtggaacc acatgggata tcccaagtag tacccgtctt ccagagtgcc aagccccggc tggactgctt gattgaagta tacaggagct gccaggagat cctggcacac cagaaagcca catcaacaag cccatga. It is sometimes possible for the material contained within the vial of "PIGH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.