PHIP cdna clone
PHIP cDNA Clone
Gene Names
PHIP; ndrp; BRWD2; WDR11; DCAF14
Synonyms
PHIP; PHIP cDNA Clone; PHIP cdna clone
Sequence
atgagtccttgggatatggagcttatacctaataatgctgtatttcctgaagaactaggtaccagtgttcctttaactgatggtgagtgcagatcactaatctataaacctcttgatggagaatggggtaccaatcccagggatgaagaatgtgaaagaattgtggcaggaataaaccagttgatgacactagatattgcctcagcatttgtggcccccgtggatctgcaagcctatcccatgtattgcacagtagtggcatatccaacggatctaagtacaattaaacaaagactggaaaacaggttttacaggcgggtttcttccctaatgtgggaagttcgatatatagagcataatacacgaacatttaatgagcctggaagccctattgtgaaatctgctaaattcgtgactgatcttcttctacattttataaaggatcagacttgttataacataattccactttataattcaatgaagaagaaagttttgtctgattctgaggatgaagagaaagatgctgatgtgccaggaacttctactcgaaaaaggaaggaccatcagcctagaagaagattacgtaatagagcccagtcttacgatattcaagcatggaagaaacagtgtgaagaattgttaaatctcatatttcaatgtgaagattcagagcctttccgtcagccggtagatctccttgaatatccagactacagagacatcattgacactccaatggattttgctaccgttagagaaactttagaggctgggaattatgagtcaccaatggagttatgtaaagatgtcagacttattttcagtaattccaaagcatatacaccaagcaaaagatcaaggatttacagcatgagtttgcgcttgtctgcattctttgaagaacacattagttcagttttatcagattataaatctgctcttcgttttcataaaagaaataccataaccaaaaggaggaagaaaagaaacagaagcagctctgtttccagtagtgctgcatcaagccctgaaaggaaaaaaaggatcttaaaaccccagctaaaatcagaaagctctacctctgcattctctacacctacacgatcaataccgccaagacacaatgctgctcagataaacggtaaaacagaatctagttctgtggttcgaaccagaagcaaccgagtggttgtagatccagttgtcactgagcaaccatctacttcttcagctgcaaagacttttattacaaaagctaatgcatctgcaataccagggaaaacaatactagagaattctgtgaaacattccaaagctttgaatactctttccagtcctggtcaatccagttttagtcatggcactaggaataattctgcaaaagaaaacatggaaaaggaaaagccagtcaaacgtaaaatgaagtcatctgtactcccaaaggcgtccactctttcaaagtcatcagctgtcattgagcaaggagattgtaagaacaacgctcttgtaccaggaaccattcaagtaaatggccatggaggacagccatcaaaacttgtgaagaggggacctggaaggaaacctaaagtagaagttaataccaatagtggtgaaattatacacaagaaaaggggtagaaagcccaaaaagctacagtatgcaaagccagaagatttagagcaaaataatgtgcatcccatcagagatgaagtacttccttcttcaacatgcaattttctttctgaaactaataatgtaaaggaagatttgttacagaaaaagaatcgtggaggtaggaagcccaaaaggaagatgaagacacaaaaattagatgcagatctcctagtccctgcaagtgtcaaagtgttaaggagaagtaaccgaaaaaagatagatgatcctatagatgaggaagaagagtttgaagaactcaaaggctctgaaccccacatgagaactagaaatcaaggtcgaaggacagctttctataatgaggatgactctgaagaggagcaaaggcagctgttgttcgaagacacctctttaacttttggaacttctagtagaggacgagtccgaaagttgactgaaaaagcaaaagctaatttaattggttggtaa
Sequence Length
2124
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
206,689 Da
NCBI Official Full Name
Homo sapiens pleckstrin homology domain interacting protein, mRNA
NCBI Official Synonym Full Names
pleckstrin homology domain interacting protein
NCBI Official Symbol
PHIP
NCBI Official Synonym Symbols
ndrp; BRWD2; WDR11; DCAF14
NCBI Protein Information
PH-interacting protein
UniProt Protein Name
PH-interacting protein
Protein Family
UniProt Gene Name
PHIP
UniProt Synonym Gene Names
WDR11; PHIP
UniProt Entry Name
PHIP_HUMAN
NCBI Description
PHIP binds the pleckstrin homology (PH) domain of insulin receptor substrate-1 (IRS1; MIM 147545), modulates insulin signaling, and plays a role in pancreatic beta cell growth and survival (Farhang-Fallah et al., 2000 [PubMed 11018022]; Podcheko et al., 2007 [PubMed 17636024]).[supplied by OMIM, Jun 2009]
Uniprot Description
PHIP: Probable regulator of the insulin and insulin-like growth factor signaling pathways. Stimulates cell proliferation through regulation of cyclin transcription and has an anti- apoptotic activity through AKT1 phosphorylation and activation. Plays a role in the regulation of cell morphology and cytoskeletal organization. Interacts with IRS1 and IRS2. Interacts (via bromo domain) with acetylated lysine residues on histone H1.4, histone H3 and H4 (in vitro)
Chromosomal Location of Human Ortholog: 6q14
Cellular Component: nucleus
Molecular Function: protein binding
Biological Process: cytoskeleton organization and biogenesis; negative regulation of apoptosis; positive regulation of cell proliferation; positive regulation of insulin-like growth factor receptor signaling pathway; positive regulation of mitosis; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; regulation of cell morphogenesis; regulation of cell shape; regulation of protein amino acid phosphorylation
Research Articles on PHIP
Similar Products
Product Notes
The PHIP phip (Catalog #AAA1270902) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtcctt gggatatgga gcttatacct aataatgctg tatttcctga agaactaggt accagtgttc ctttaactga tggtgagtgc agatcactaa tctataaacc tcttgatgga gaatggggta ccaatcccag ggatgaagaa tgtgaaagaa ttgtggcagg aataaaccag ttgatgacac tagatattgc ctcagcattt gtggcccccg tggatctgca agcctatccc atgtattgca cagtagtggc atatccaacg gatctaagta caattaaaca aagactggaa aacaggtttt acaggcgggt ttcttcccta atgtgggaag ttcgatatat agagcataat acacgaacat ttaatgagcc tggaagccct attgtgaaat ctgctaaatt cgtgactgat cttcttctac attttataaa ggatcagact tgttataaca taattccact ttataattca atgaagaaga aagttttgtc tgattctgag gatgaagaga aagatgctga tgtgccagga acttctactc gaaaaaggaa ggaccatcag cctagaagaa gattacgtaa tagagcccag tcttacgata ttcaagcatg gaagaaacag tgtgaagaat tgttaaatct catatttcaa tgtgaagatt cagagccttt ccgtcagccg gtagatctcc ttgaatatcc agactacaga gacatcattg acactccaat ggattttgct accgttagag aaactttaga ggctgggaat tatgagtcac caatggagtt atgtaaagat gtcagactta ttttcagtaa ttccaaagca tatacaccaa gcaaaagatc aaggatttac agcatgagtt tgcgcttgtc tgcattcttt gaagaacaca ttagttcagt tttatcagat tataaatctg ctcttcgttt tcataaaaga aataccataa ccaaaaggag gaagaaaaga aacagaagca gctctgtttc cagtagtgct gcatcaagcc ctgaaaggaa aaaaaggatc ttaaaacccc agctaaaatc agaaagctct acctctgcat tctctacacc tacacgatca ataccgccaa gacacaatgc tgctcagata aacggtaaaa cagaatctag ttctgtggtt cgaaccagaa gcaaccgagt ggttgtagat ccagttgtca ctgagcaacc atctacttct tcagctgcaa agacttttat tacaaaagct aatgcatctg caataccagg gaaaacaata ctagagaatt ctgtgaaaca ttccaaagct ttgaatactc tttccagtcc tggtcaatcc agttttagtc atggcactag gaataattct gcaaaagaaa acatggaaaa ggaaaagcca gtcaaacgta aaatgaagtc atctgtactc ccaaaggcgt ccactctttc aaagtcatca gctgtcattg agcaaggaga ttgtaagaac aacgctcttg taccaggaac cattcaagta aatggccatg gaggacagcc atcaaaactt gtgaagaggg gacctggaag gaaacctaaa gtagaagtta ataccaatag tggtgaaatt atacacaaga aaaggggtag aaagcccaaa aagctacagt atgcaaagcc agaagattta gagcaaaata atgtgcatcc catcagagat gaagtacttc cttcttcaac atgcaatttt ctttctgaaa ctaataatgt aaaggaagat ttgttacaga aaaagaatcg tggaggtagg aagcccaaaa ggaagatgaa gacacaaaaa ttagatgcag atctcctagt ccctgcaagt gtcaaagtgt taaggagaag taaccgaaaa aagatagatg atcctataga tgaggaagaa gagtttgaag aactcaaagg ctctgaaccc cacatgagaa ctagaaatca aggtcgaagg acagctttct ataatgagga tgactctgaa gaggagcaaa ggcagctgtt gttcgaagac acctctttaa cttttggaac ttctagtaga ggacgagtcc gaaagttgac tgaaaaagca aaagctaatt taattggttg gtaa. It is sometimes possible for the material contained within the vial of "PHIP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
