Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PHF23 cdna clone

PHF23 cDNA Clone

Synonyms
PHF23; PHF23 cDNA Clone; PHF23 cdna clone
Ordering
For Research Use Only!
Sequence
atgctggaagccatggcggagcccagtcccgaagatccacctccgacccttaagccagagactcagccaccagagaaacggcggagaacaattgaggatttcaacaaattctgcagttttgttttggcatatgctggttacattccccctagcaaagaggaaagtgactggccagcctctggctccagctctccattgcgaggagagagtgcggccgacagtgatggctgggactcggccccctcagatcttcgaaccatccagacttttgttaagaaagcaaagtcatccaagagaagggcagctcaagcaggtcccacccagccaggacccccaaggtccactttctctcgtctgcaggcccccgacagtgctaccttgcttgagaagatgaagctcaaggactctctctttgatctggatgggcccaaagtggcatctcctttgtcccccacatccctgacacatacctcccggccccctgctgctcttacccccgtgcccctttcccagggggacctctcccatcctcctcgaaagaaggaccgaaagaaccgaaagttggggccaggagctggggctggctttggggtgcttcggaggcctcggccaactcctggggatggggaaaagagatctcgaatcaagaagagcaagaagcggaagttaaaaaaggcagaacggggggatagactcccacctcctgggcctccccaggcaccccccagtgatacagactctgaagaggaggaggaagaggaggaagaggaagaagaagaagagatggcaacagtggtagggggtgaagccccagtccctgtgctgccaacaccccctgaggctcctaggccccctgccacagtgcaccctgaaggagtccctcctgctgacagtgaaagcaaggaggtgggcagcactgaaacaagccaagatggagatgccagctccagtgaaggcgagatgcgggtcatggacgaggacatcatggtagaatcaggtgatgactcatgggatctgatcacatgttactgtcgaaagccctttgcagggcggcccatgattgagtgcagcctgtgtgggacgtggatccacctctcctgtgctaagattaagaagaccaacgtccccgacttcttttattgccagaaatgcaaggaactgaggccagaggcccggcggttaggggggcctcccaaatctggagagccctga
Sequence Length
1212
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,448 Da
NCBI Official Full Name
Homo sapiens PHD finger protein 23, mRNA
UniProt Protein Name
PHD finger protein 23
Protein Family
UniProt Gene Name
PHF23
UniProt Entry Name
PHF23_HUMAN

Uniprot Description

PHF23: A chromosomal aberration involving PHF23 is found in a patient with acute myeloid leukemia (AML). Translocation t(11;17)(p15;p13) with NUP98. Belongs to the PHF23 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 17p13.1

Molecular Function: protein binding

Biological Process: positive regulation of protein ubiquitination

Similar Products

Product Notes

The PHF23 phf23 (Catalog #AAA1267526) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggaag ccatggcgga gcccagtccc gaagatccac ctccgaccct taagccagag actcagccac cagagaaacg gcggagaaca attgaggatt tcaacaaatt ctgcagtttt gttttggcat atgctggtta cattccccct agcaaagagg aaagtgactg gccagcctct ggctccagct ctccattgcg aggagagagt gcggccgaca gtgatggctg ggactcggcc ccctcagatc ttcgaaccat ccagactttt gttaagaaag caaagtcatc caagagaagg gcagctcaag caggtcccac ccagccagga cccccaaggt ccactttctc tcgtctgcag gcccccgaca gtgctacctt gcttgagaag atgaagctca aggactctct ctttgatctg gatgggccca aagtggcatc tcctttgtcc cccacatccc tgacacatac ctcccggccc cctgctgctc ttacccccgt gcccctttcc cagggggacc tctcccatcc tcctcgaaag aaggaccgaa agaaccgaaa gttggggcca ggagctgggg ctggctttgg ggtgcttcgg aggcctcggc caactcctgg ggatggggaa aagagatctc gaatcaagaa gagcaagaag cggaagttaa aaaaggcaga acggggggat agactcccac ctcctgggcc tccccaggca ccccccagtg atacagactc tgaagaggag gaggaagagg aggaagagga agaagaagaa gagatggcaa cagtggtagg gggtgaagcc ccagtccctg tgctgccaac accccctgag gctcctaggc cccctgccac agtgcaccct gaaggagtcc ctcctgctga cagtgaaagc aaggaggtgg gcagcactga aacaagccaa gatggagatg ccagctccag tgaaggcgag atgcgggtca tggacgagga catcatggta gaatcaggtg atgactcatg ggatctgatc acatgttact gtcgaaagcc ctttgcaggg cggcccatga ttgagtgcag cctgtgtggg acgtggatcc acctctcctg tgctaagatt aagaagacca acgtccccga cttcttttat tgccagaaat gcaaggaact gaggccagag gcccggcggt taggggggcc tcccaaatct ggagagccct ga. It is sometimes possible for the material contained within the vial of "PHF23, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.