PHF17 cdna clone
PHF17 cDNA Clone
Gene Names
JADE1; PHF17
Synonyms
PHF17; PHF17 cDNA Clone; PHF17 cdna clone
Sequence
atgaaacgaggtcgccttcccagcagcagtgaggattctgacgacaatggcagcctgtcaactacttggtcccagaattcccgatcccagcataggagaagctcctgctccagacatgaagatcgaaagccttcagaggtgtttaggacagacctgatcactgccatgaagttgcatgactcctaccagctgaatccggatgagtactatgtgttggcagatccctggagacaggaatgggagaaaggggtccaggtgcctgtgagcccggggaccatccctcagcctgtggccagggttgtgtctgaagagaaatccctcatgttcatcaggcccaagaagtacatcgtgtcatcaggctctgagcctcccgagttgggctatgtggacatccggacgctggctgacagcgtgtgtcgctatgacctcaatgacatggatgctgcatggctggaactgaccaatgaagaatttaaggagatgggaatgcctgaactagatgaatacaccatggagagggtcctagaggaatttgagcagcgatgctacgacaatatgaatcatgccatagagactgaggaaggcctggggatcgaatatgatgaagatgttgtctgtgatgtctgccagtctcctgatggtgaggacggcaatgagatggtgttctgtgacaaatgcaacatctgtgtgcaccaggcctgttatggaatcctcaaggtaccagagggcagctggctgtgccggacatgtgccctgggggttcagccaaaatgtctgctgtgtccgaagaagggtggagctatgaagcccacccgtagcggaaccaagtgggtccacgttagctgtgctctgtggatccctgaggtgagcattggcagcccagagaagatggagcccatcaccaaggtgtcacacattcccagcagccggtgggcgctagtgtgcagcctctgcaatgagaagtttggggcctctatacagtgctctgtgaagaactgccgcacagccttccatgtgacctgtgcttttgaccggggcctggagatgaagaccatcttagcagagaatgatgaagtcaagttcaagtcctattgcccaaagcacagctcacataggaaacccgaggagagtcttggcaagggggctgcacaggagaatggggcccctgagtgttccccccggaatccgctggagccctttgccagccttgagcagaaccgggaggaggcccaccgggtgagtgtccgtaagcagaagctgcagcagttggaggatgagttctacaccttcgtcaacctgctggatgttgccagggctctgcggctgcctgaggaagtagtggatttcctgtaccagtactggaagttgaagaggaaggtcaacttcaacaagcccctgatcaccccaaagaaagatgaagaggacaatctagccaagcgggagcaggatgtcttatttaggaggctgcagctgttcacgcacctgcggcaggacctggagagggtaatgattgacactgacaccttatag
Sequence Length
1530
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
58,370 Da
NCBI Official Full Name
Homo sapiens PHD finger protein 17, mRNA
NCBI Official Synonym Full Names
jade family PHD finger 1
NCBI Official Symbol
JADE1
NCBI Official Synonym Symbols
PHF17
NCBI Protein Information
protein Jade-1
UniProt Protein Name
Protein Jade-1
UniProt Gene Name
JADE1
UniProt Synonym Gene Names
KIAA1807; PHF17
UniProt Entry Name
JADE1_HUMAN
Uniprot Description
JADE1: Component of the HBO1 complex which has a histone H4- specific acetyltransferase activity, a reduced activity toward histone H3 and is responsible for the bulk of histone H4 acetylation in vivo. Transcriptional coactivator it may also promote acetylation of nucleosomal histone H4 by KAT5. Promotes apoptosis. May act as a renal tumor suppressor. Belongs to the JADE family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Tumor suppressor
Chromosomal Location of Human Ortholog: 4q26-q27
Cellular Component: cytoplasm; histone acetyltransferase complex; nucleoplasm; nucleus; plasma membrane
Molecular Function: protein binding
Research Articles on PHF17
Similar Products
Product Notes
The PHF17 jade1 (Catalog #AAA1267215) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaacgag gtcgccttcc cagcagcagt gaggattctg acgacaatgg cagcctgtca actacttggt cccagaattc ccgatcccag cataggagaa gctcctgctc cagacatgaa gatcgaaagc cttcagaggt gtttaggaca gacctgatca ctgccatgaa gttgcatgac tcctaccagc tgaatccgga tgagtactat gtgttggcag atccctggag acaggaatgg gagaaagggg tccaggtgcc tgtgagcccg gggaccatcc ctcagcctgt ggccagggtt gtgtctgaag agaaatccct catgttcatc aggcccaaga agtacatcgt gtcatcaggc tctgagcctc ccgagttggg ctatgtggac atccggacgc tggctgacag cgtgtgtcgc tatgacctca atgacatgga tgctgcatgg ctggaactga ccaatgaaga atttaaggag atgggaatgc ctgaactaga tgaatacacc atggagaggg tcctagagga atttgagcag cgatgctacg acaatatgaa tcatgccata gagactgagg aaggcctggg gatcgaatat gatgaagatg ttgtctgtga tgtctgccag tctcctgatg gtgaggacgg caatgagatg gtgttctgtg acaaatgcaa catctgtgtg caccaggcct gttatggaat cctcaaggta ccagagggca gctggctgtg ccggacatgt gccctggggg ttcagccaaa atgtctgctg tgtccgaaga agggtggagc tatgaagccc acccgtagcg gaaccaagtg ggtccacgtt agctgtgctc tgtggatccc tgaggtgagc attggcagcc cagagaagat ggagcccatc accaaggtgt cacacattcc cagcagccgg tgggcgctag tgtgcagcct ctgcaatgag aagtttgggg cctctataca gtgctctgtg aagaactgcc gcacagcctt ccatgtgacc tgtgcttttg accggggcct ggagatgaag accatcttag cagagaatga tgaagtcaag ttcaagtcct attgcccaaa gcacagctca cataggaaac ccgaggagag tcttggcaag ggggctgcac aggagaatgg ggcccctgag tgttcccccc ggaatccgct ggagcccttt gccagccttg agcagaaccg ggaggaggcc caccgggtga gtgtccgtaa gcagaagctg cagcagttgg aggatgagtt ctacaccttc gtcaacctgc tggatgttgc cagggctctg cggctgcctg aggaagtagt ggatttcctg taccagtact ggaagttgaa gaggaaggtc aacttcaaca agcccctgat caccccaaag aaagatgaag aggacaatct agccaagcgg gagcaggatg tcttatttag gaggctgcag ctgttcacgc acctgcggca ggacctggag agggtaatga ttgacactga caccttatag. It is sometimes possible for the material contained within the vial of "PHF17, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
