PHF15 cdna clone
PHF15 cDNA Clone
Gene Names
JADE2; PHF15; JADE-2
Synonyms
PHF15; PHF15 cDNA Clone; PHF15 cdna clone
Sequence
atggccatgagcgagtggccactgaacaatgggcaccgcgaggaccctgctccagggctgctgtcagaggaactgctgcaggacgaggagacactgctcagcttcatgcgggacccctcgctgcgacctggtgaccctgctaggaaggcccgaggccgcacccgcctgcctgccaagaagaaaccaccaccaccaccaccgcaggacgggcctggttcacggacgactccagacaaagcccccaagaagacctggggccaggatgcaggcagtggcaaggggggtcaagggccacctaccaggaagccaccacgtcggacatcttctcacttgccgtccagccctgcagccggggactgtcccatcctagccacccctgaaagccccccgccactggcccctgagaccccggacgaggcagcctcagtagctgctgactcagatgtccaagtgcctggccctgcagcaagccctaagcctttgggccggctccggccaccccgcgagagcaaggtaacccggagattgccgggtgccaggcctgatgctgggatgggaccaccttcagctgtggctgagaggcccaagatcagcctgcattttgacactgagactgatggctacttctctgatggggagatgagcgactcagatgtagaggccgaggacggtggggtgcagcggggtccccgggaggcaggggcagaggaggtggtccgcatgggcgtactggcctcctaa
Sequence Length
741
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
63,466 Da
NCBI Official Full Name
Homo sapiens PHD finger protein 15, mRNA
NCBI Official Synonym Full Names
jade family PHD finger 2
NCBI Official Symbol
JADE2
NCBI Official Synonym Symbols
PHF15; JADE-2
NCBI Protein Information
protein Jade-2
UniProt Protein Name
Protein Jade-2
UniProt Gene Name
JADE2
UniProt Synonym Gene Names
KIAA0239; PHF15
UniProt Entry Name
JADE2_HUMAN
Uniprot Description
JADE2: Component of the HBO1 complex which has a histone H4- specific acetyltransferase activity, a reduced activity toward histone H3 and is responsible for the bulk of histone H4 acetylation in vivo. Belongs to the JADE family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 5q31.1
Cellular Component: histone acetyltransferase complex; nucleoplasm
Molecular Function: protein binding
Similar Products
Product Notes
The PHF15 jade2 (Catalog #AAA1270684) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccatga gcgagtggcc actgaacaat gggcaccgcg aggaccctgc tccagggctg ctgtcagagg aactgctgca ggacgaggag acactgctca gcttcatgcg ggacccctcg ctgcgacctg gtgaccctgc taggaaggcc cgaggccgca cccgcctgcc tgccaagaag aaaccaccac caccaccacc gcaggacggg cctggttcac ggacgactcc agacaaagcc cccaagaaga cctggggcca ggatgcaggc agtggcaagg ggggtcaagg gccacctacc aggaagccac cacgtcggac atcttctcac ttgccgtcca gccctgcagc cggggactgt cccatcctag ccacccctga aagccccccg ccactggccc ctgagacccc ggacgaggca gcctcagtag ctgctgactc agatgtccaa gtgcctggcc ctgcagcaag ccctaagcct ttgggccggc tccggccacc ccgcgagagc aaggtaaccc ggagattgcc gggtgccagg cctgatgctg ggatgggacc accttcagct gtggctgaga ggcccaagat cagcctgcat tttgacactg agactgatgg ctacttctct gatggggaga tgagcgactc agatgtagag gccgaggacg gtggggtgca gcggggtccc cgggaggcag gggcagagga ggtggtccgc atgggcgtac tggcctccta a. It is sometimes possible for the material contained within the vial of "PHF15, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
