Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PHAX cdna clone

PHAX cDNA Clone

Gene Names
PHAX; RNUXA
Synonyms
PHAX; PHAX cDNA Clone; PHAX cdna clone
Ordering
For Research Use Only!
Sequence
atggcgttggaggtcggcgatatggaagatgggcagctttccgactcggattccgacatgacggtcgcacccagcgacaggccgctgcaattgccaaaagtgctaggtggcgacagtgctatgagggccttccagaacacggcaactgcatgtgcaccagtatcacattatcgagctgttgaaagtgtggattcaagtgaagaaagtttttctgattcagatgatgatagctgtctttggaaacgcaaacgacagaaatgttttaaccctcctcccaaaccagagccttttcagtttggccagagcagtcagaaaccacctgttgctggaggaaagaagattaacaacatatggggtgctgtgctgcaggaacagaatcaagatgcagtggccactgaacttggtatcttgggaatggagggcactattgacagaagcagacaatccgagacctacaattatttgcttgccaagaaacttaggaaggaatctcaagagcatacaaaagatctagacaaggaactagatgaatatatgcatggtggcaaaaaaatgggatcaaaggaagaggaaaatgggcaaggtcatctcaaaaggaaacgacctgtcaaagacaggctagggaacagaccagaaatgaactataaaggtcgatacgagatcacagcggaagattctcaagagaaagtggctgatgaaatttcattcaggttacaggaaccaaagaaagacctgatagcccgagtagtgaggattattggtaacaaaaaggcaattgaacttctgatggaaaccgctgaagttgaacaaaatggtggtctctttataatgaatggtagtcgaagaagaacaccaggtggagtttttctgaatctcttgaaaaacactcctagtatcagcgaggaacaaattaaggacattttctacattgaaaaccaaaaggaatatgaaaataaaaaagctgctaggaagaggagaacacaagtgttggggaaaaagatgaaacaagctattaaaagtctaaattttcaagaagatgatgatacatcacgagaaacttttgcaagtgacacgaatgaggccttggcctctcttgatgagtcacaggaaggacatgcagaagccaagttggaggcagaggaagccattgaagttgatcattctcatgatttggacatcttttaa
Sequence Length
1185
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,403 Da
NCBI Official Full Name
Homo sapiens phosphorylated adaptor for RNA export, mRNA
NCBI Official Synonym Full Names
phosphorylated adaptor for RNA export
NCBI Official Symbol
PHAX
NCBI Official Synonym Symbols
RNUXA
NCBI Protein Information
phosphorylated adapter RNA export protein
UniProt Protein Name
Phosphorylated adapter RNA export protein
UniProt Gene Name
PHAX
UniProt Synonym Gene Names
RNUXA
UniProt Entry Name
PHAX_HUMAN

Uniprot Description

RNUXA: A phosphoprotein adapter involved in the XPO1-mediated U snRNA export from the nucleus. Bridge components required for U snRNA export, the cap binding complex (CBC)-bound snRNA on the one hand and the GTPase Ran in its active GTP-bound form together with the export receptor XPO1 on the other. Its phosphorylation in the nucleus is required for U snRNA export complex assembly and export, while its dephosphorylation in the cytoplasm causes export complex disassembly. It is recycled back to the nucleus via the importin alpha/beta heterodimeric import receptor. The directionality of nuclear export is thought to be conferred by an asymmetric distribution of the GTP- and GDP-bound forms of Ran between the cytoplasm and nucleus. Its compartmentalized phosphorylation cycle may also contribute to the directionality of export. Binds strongly to m7G-capped U1 and U5 small nuclear RNAs (snRNAs) in a sequence-unspecific manner and phosphorylation- independent manner. Plays also a role in the biogenesis of U3 small nucleolar RNA (snoRNA). Involved in the U3 snoRNA transport from nucleoplasm to Cajal bodies. Binds strongly to m7G-capped U3, U8 and U13 precursor snoRNAs and weakly to trimethylated (TMG)-capped U3, U8 and U13 snoRNAs. Binds also to telomerase RNA. Belongs to the PHAX family.

Protein type: Nuclear import; RNA-binding

Chromosomal Location of Human Ortholog: 5q23.2

Cellular Component: centrosome; cytosol; intracellular membrane-bound organelle; nucleoplasm; nucleus

Molecular Function: protein binding

Biological Process: nuclear export; snRNA export from nucleus; snRNA transcription from RNA polymerase II promoter

Research Articles on PHAX

Similar Products

Product Notes

The PHAX phax (Catalog #AAA1270798) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgttgg aggtcggcga tatggaagat gggcagcttt ccgactcgga ttccgacatg acggtcgcac ccagcgacag gccgctgcaa ttgccaaaag tgctaggtgg cgacagtgct atgagggcct tccagaacac ggcaactgca tgtgcaccag tatcacatta tcgagctgtt gaaagtgtgg attcaagtga agaaagtttt tctgattcag atgatgatag ctgtctttgg aaacgcaaac gacagaaatg ttttaaccct cctcccaaac cagagccttt tcagtttggc cagagcagtc agaaaccacc tgttgctgga ggaaagaaga ttaacaacat atggggtgct gtgctgcagg aacagaatca agatgcagtg gccactgaac ttggtatctt gggaatggag ggcactattg acagaagcag acaatccgag acctacaatt atttgcttgc caagaaactt aggaaggaat ctcaagagca tacaaaagat ctagacaagg aactagatga atatatgcat ggtggcaaaa aaatgggatc aaaggaagag gaaaatgggc aaggtcatct caaaaggaaa cgacctgtca aagacaggct agggaacaga ccagaaatga actataaagg tcgatacgag atcacagcgg aagattctca agagaaagtg gctgatgaaa tttcattcag gttacaggaa ccaaagaaag acctgatagc ccgagtagtg aggattattg gtaacaaaaa ggcaattgaa cttctgatgg aaaccgctga agttgaacaa aatggtggtc tctttataat gaatggtagt cgaagaagaa caccaggtgg agtttttctg aatctcttga aaaacactcc tagtatcagc gaggaacaaa ttaaggacat tttctacatt gaaaaccaaa aggaatatga aaataaaaaa gctgctagga agaggagaac acaagtgttg gggaaaaaga tgaaacaagc tattaaaagt ctaaattttc aagaagatga tgatacatca cgagaaactt ttgcaagtga cacgaatgag gccttggcct ctcttgatga gtcacaggaa ggacatgcag aagccaagtt ggaggcagag gaagccattg aagttgatca ttctcatgat ttggacatct tttaa. It is sometimes possible for the material contained within the vial of "PHAX, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.