Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PES1 cdna clone

PES1 cDNA Clone

Gene Names
PES1; PES
Synonyms
PES1; PES1 cDNA Clone; PES1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggaggccttgagaagaagaagtatgaacgaggctcggccaccaactacatcacccggaacaaagcccggaagaagctccagctgagcttggctgactttaggcggctgtgcattctgaagggcatttatccccatgaacccaaacacaagaagaaggttaacaagggttctacagcagcccgaacgttttaccttatcaaagacatcaggtttctcctccacgaacccattgtcaacaagttccgtgaatacaaggtgttcgtccggaagctccggaaggcttatgggaagagcgagtggaacactgtagagcgtttaaaggacaataagcccaactacaaactcgaccacatcatcaaggaacggtatcccacgttcatcgatgccctgcgggacctggacgatgccctctccatgtgcttcctgttttccaccttcccgcggactggcaagtgccacgtgcagaccattcagctgtgccgccggctcactgtggagttcatgcactacattatcgctgcccgtgccctgcgcaaggtcttcctgtccatcaaaggcatttactaccaggccgaggtactggggcagcccatcgtgtggatcactccctatgccttctcccatgaccacccgacagacgtggactacagggtcatggccaccttcaccgagttctacaccacgctgctgggctttgtcaacttccgcctttaccagttgctcaacctccactatcccccgaagctcgagggtcaggcccaagcagaggcaaaggccggtgagggcacctacgcgttggactccgagagttgtatggagaaactggcagccctcagtgccagcctggcccgcgtggtggtgcctgccacagaggaggaggccgaggtggatgagtttcccaccgatggggagatgtcagcgcaggaggaagaccgcaggaaggagctggaggcgcaggagaagcacaagaagctttttgagggcctgaagttcttcctgaaccgagaggtgccccgtgaggccctggccttcatcatcaggagttttggtggggaagtgtcctgggacaaatctttgtgcattggggccacctatgacgtcacagactcccgcatcacccatcagattgtcgaccggcctgggcagcagacctcagtcattggcaggtgctacgtgcagccccagtgggtgtttgactcagtgaacgccaggctccttctccccgtggcagagtacttctctggggtgcagctgcccccacacctttcaccctttgtgaccgagaaggaaggagattacgttccacctgagaagctgaagctgctggctctgcagcggggagaggacccaggaaacctgaatgagtcagaagaggaggaggaagaggacgacaacaacgaaggtgatggtgatgaagagggagaaaatgaggaggaggaggaagatgcagaggctggttcagaaaaggaggaagaggcccggctggcagccctggaagagcagaggatggaggggaagaagcccagggtgatggcaggcaccttgaagctggaggataagcagcggctggcccaggaggaggagagtgaggccaagcgcctggccattatgatgatgaagaagcgggagaagtacctgtaccagaagatcatgtttggcaagaggcgaaaaatccgagaggccaacaagctggcggagaagcggaaagcccacgatgaggcggtgaggtctgagaagaaggccaagaaggcaaggccggagtga
Sequence Length
1767
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
67,456 Da
NCBI Official Full Name
Homo sapiens pescadillo homolog 1, containing BRCT domain (zebrafish), mRNA
NCBI Official Synonym Full Names
pescadillo ribosomal biogenesis factor 1
NCBI Official Symbol
PES1
NCBI Official Synonym Symbols
PES
NCBI Protein Information
pescadillo homolog
UniProt Protein Name
Pescadillo homolog
UniProt Gene Name
PES1
UniProt Entry Name
PESC_HUMAN

NCBI Description

This gene encodes a nuclear protein that contains a breast cancer associated gene 1 (BRCA1) C-terminal interaction domain. The encoded protein interacts with BOP1 and WDR12 to form the PeBoW complex, which plays a critical role in cell proliferation via pre-rRNA processing and 60S ribosomal subunit maturation. Expression of this gene may play an important role in breast cancer proliferation and tumorigenicity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Pseudogenes of this gene are located on the long arm of chromosome 4 and the short arm of chromosome 9. [provided by RefSeq, Aug 2011]

Uniprot Description

PES1: Component of the PeBoW complex, which is required for maturation of 28S and 5.8S ribosomal RNAs and formation of the 60S ribosome. Belongs to the pescadillo family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Nucleolus; Translation; RNA-binding

Chromosomal Location of Human Ortholog: 22q12.1

Cellular Component: cytoplasm; membrane; nucleolus; nucleoplasm; nucleus

Molecular Function: protein binding; RNA binding

Biological Process: cell proliferation; maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA); maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA); regulation of cell cycle; ribosomal large subunit biogenesis and assembly; rRNA processing

Research Articles on PES1

Similar Products

Product Notes

The PES1 pes1 (Catalog #AAA1277885) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggaggcc ttgagaagaa gaagtatgaa cgaggctcgg ccaccaacta catcacccgg aacaaagccc ggaagaagct ccagctgagc ttggctgact ttaggcggct gtgcattctg aagggcattt atccccatga acccaaacac aagaagaagg ttaacaaggg ttctacagca gcccgaacgt tttaccttat caaagacatc aggtttctcc tccacgaacc cattgtcaac aagttccgtg aatacaaggt gttcgtccgg aagctccgga aggcttatgg gaagagcgag tggaacactg tagagcgttt aaaggacaat aagcccaact acaaactcga ccacatcatc aaggaacggt atcccacgtt catcgatgcc ctgcgggacc tggacgatgc cctctccatg tgcttcctgt tttccacctt cccgcggact ggcaagtgcc acgtgcagac cattcagctg tgccgccggc tcactgtgga gttcatgcac tacattatcg ctgcccgtgc cctgcgcaag gtcttcctgt ccatcaaagg catttactac caggccgagg tactggggca gcccatcgtg tggatcactc cctatgcctt ctcccatgac cacccgacag acgtggacta cagggtcatg gccaccttca ccgagttcta caccacgctg ctgggctttg tcaacttccg cctttaccag ttgctcaacc tccactatcc cccgaagctc gagggtcagg cccaagcaga ggcaaaggcc ggtgagggca cctacgcgtt ggactccgag agttgtatgg agaaactggc agccctcagt gccagcctgg cccgcgtggt ggtgcctgcc acagaggagg aggccgaggt ggatgagttt cccaccgatg gggagatgtc agcgcaggag gaagaccgca ggaaggagct ggaggcgcag gagaagcaca agaagctttt tgagggcctg aagttcttcc tgaaccgaga ggtgccccgt gaggccctgg ccttcatcat caggagtttt ggtggggaag tgtcctggga caaatctttg tgcattgggg ccacctatga cgtcacagac tcccgcatca cccatcagat tgtcgaccgg cctgggcagc agacctcagt cattggcagg tgctacgtgc agccccagtg ggtgtttgac tcagtgaacg ccaggctcct tctccccgtg gcagagtact tctctggggt gcagctgccc ccacaccttt caccctttgt gaccgagaag gaaggagatt acgttccacc tgagaagctg aagctgctgg ctctgcagcg gggagaggac ccaggaaacc tgaatgagtc agaagaggag gaggaagagg acgacaacaa cgaaggtgat ggtgatgaag agggagaaaa tgaggaggag gaggaagatg cagaggctgg ttcagaaaag gaggaagagg cccggctggc agccctggaa gagcagagga tggaggggaa gaagcccagg gtgatggcag gcaccttgaa gctggaggat aagcagcggc tggcccagga ggaggagagt gaggccaagc gcctggccat tatgatgatg aagaagcggg agaagtacct gtaccagaag atcatgtttg gcaagaggcg aaaaatccga gaggccaaca agctggcgga gaagcggaaa gcccacgatg aggcggtgag gtctgagaag aaggccaaga aggcaaggcc ggagtga. It is sometimes possible for the material contained within the vial of "PES1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.