Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PELO cdna clone

PELO cDNA Clone

Gene Names
PELO; CGI-17; PRO1770
Synonyms
PELO; PELO cDNA Clone; PELO cdna clone
Ordering
For Research Use Only!
Sequence
atgaagctcgtgaggaagaacatcgagaaggacaatgcgggccaggtgaccctggtccccgaggagcctgaggacatgtggcacacttacaacctcgtgcaggtgggcgacagcctgcgcgcctccaccatccgcaaggtacagacagagtcctccacgggcagcgtgggcagcaaccgggtccgcactaccctcactctctgcgtggaggccatcgacttcgactctcaagcctgccagctgcgggttaaggggaccaacatccaagagaatgagtatgtcaagatgggggcttaccacaccatcgagctggagcccaaccgccagttcaccctggccaagaagcagtgggatagtgtggtactggagcgcatcgagcaggcctgtgacccagcctggagcgctgatgtggcggctgtggtcatgcaggaaggcctcgcccatatctgcttagtcactcccagcatgaccctcactcgggccaaggtggaggtgaacatccctaggaaaaggaaaggcaattgctctcagcatgaccgggccttggagcggttctatgaacaggtggtccaggctatccagcgccacatacactttgatgttgtaaagtgcatcctggtggccagcccaggatttgtgagggagcagttctgcgactacatgtttcaacaagcagtgaagaccgacaacaaactgctcctggaaaaccggtccaaatttcttcaggtacatgcctcctccggacacaagtactccctgaaagaggccctttgtgaccctactgtggctagccgcctttcagacactaaagctgctggggaagtcaaagccttggatgacttctataaaatgttacagcatgaaccggatcgagctttctatggactcaagcaggtggagaaggccaatgaagccatggcaattgacacattgctcatcagcgatgagctcttcaggcatcaggatgtagccacacggagccggtatgtgaggctggtggacagtgtgaaagagaatgcaggcaccgttaggatattctctagtcttcacgtttctggggaacagctcagccagttgactggggtagctgccattctccgcttccctgttcccgaactttctgaccaagagggtgattccagttctgaagaggattaa
Sequence Length
1158
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,359 Da
NCBI Official Full Name
Homo sapiens pelota homolog (Drosophila), mRNA
NCBI Official Synonym Full Names
pelota homolog (Drosophila)
NCBI Official Symbol
PELO
NCBI Official Synonym Symbols
CGI-17; PRO1770
NCBI Protein Information
protein pelota homolog
UniProt Protein Name
Protein pelota homolog
Protein Family
UniProt Gene Name
PELO
UniProt Entry Name
PELO_HUMAN

NCBI Description

This gene encodes a protein which contains a conserved nuclear localization signal. The encoded protein may have a role in spermatogenesis, cell cycle control, and in meiotic cell division. [provided by RefSeq, Jul 2008]

Uniprot Description

PELO: Required for normal chromosome segregation during cell division and genomic stability. May function in recognizing stalled ribosomes and triggering endonucleolytic cleavage of the mRNA, a mechanism to release non-functional ribosomes and degrade damaged mRNAs. May have ribonuclease activity (Potential). Belongs to the eukaryotic release factor 1 family. Pelota subfamily.

Protein type: Hydrolase; EC 3.1.-.-

Chromosomal Location of Human Ortholog: 5q11.2

Molecular Function: protein binding

Research Articles on PELO

Similar Products

Product Notes

The PELO pelo (Catalog #AAA1276530) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagctcg tgaggaagaa catcgagaag gacaatgcgg gccaggtgac cctggtcccc gaggagcctg aggacatgtg gcacacttac aacctcgtgc aggtgggcga cagcctgcgc gcctccacca tccgcaaggt acagacagag tcctccacgg gcagcgtggg cagcaaccgg gtccgcacta ccctcactct ctgcgtggag gccatcgact tcgactctca agcctgccag ctgcgggtta aggggaccaa catccaagag aatgagtatg tcaagatggg ggcttaccac accatcgagc tggagcccaa ccgccagttc accctggcca agaagcagtg ggatagtgtg gtactggagc gcatcgagca ggcctgtgac ccagcctgga gcgctgatgt ggcggctgtg gtcatgcagg aaggcctcgc ccatatctgc ttagtcactc ccagcatgac cctcactcgg gccaaggtgg aggtgaacat ccctaggaaa aggaaaggca attgctctca gcatgaccgg gccttggagc ggttctatga acaggtggtc caggctatcc agcgccacat acactttgat gttgtaaagt gcatcctggt ggccagccca ggatttgtga gggagcagtt ctgcgactac atgtttcaac aagcagtgaa gaccgacaac aaactgctcc tggaaaaccg gtccaaattt cttcaggtac atgcctcctc cggacacaag tactccctga aagaggccct ttgtgaccct actgtggcta gccgcctttc agacactaaa gctgctgggg aagtcaaagc cttggatgac ttctataaaa tgttacagca tgaaccggat cgagctttct atggactcaa gcaggtggag aaggccaatg aagccatggc aattgacaca ttgctcatca gcgatgagct cttcaggcat caggatgtag ccacacggag ccggtatgtg aggctggtgg acagtgtgaa agagaatgca ggcaccgtta ggatattctc tagtcttcac gtttctgggg aacagctcag ccagttgact ggggtagctg ccattctccg cttccctgtt cccgaacttt ctgaccaaga gggtgattcc agttctgaag aggattaa. It is sometimes possible for the material contained within the vial of "PELO, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.