Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PELI1 cdna clone

PELI1 cDNA Clone

Synonyms
PELI1; PELI1 cDNA Clone; PELI1 cdna clone
Ordering
For Research Use Only!
Sequence
atgttttctcctgatcaagaaaatcatccatctaaagcaccagtaaaatatggtgaactcattgtcttagggtataatgggtctctcccaaatggcgatagaggaaggaggaaaagtaggtttgctttgtttaaaagacctaaggcaaatggggtgaagcccagcactgtgcatattgcttgtactcctcaggctgcaaaggcaataagcaacaaagaccagcatagcatatcatatactttgtctcgggcccagactgtggtggttgaatatactcatgacagcaacacagatatgtttcagattggccggtcgactgaaagccccattgattttgtagtaactgacacggttcctggaagtcaaagtaattctgatacacagtcagtacaaagcactatatcaagatttgcctgcagaatcatatgtgaacggaatcctccctttacagcacggatttatgctgcaggatttgactcatcaaaaaacatctttcttggggagaaggctgccaaatggaagacatcagatggacagatggatggcttgaccactaatggtgttcttgtgatgcatccacgcaatgggttcacagaagactccaagcctggaatatggagagaaatatcggtgtgtggaaatgtatttagcctacgtgaaaccagatcggctcagcagagaggaaaaatggtggaaattgaaaccaatcagttacaagatggctcgttaattgacctctgtggtgcaacattgttatggcgtactgcagaaggcctttcccacactcctaccgtgaagcatttagaagctttaagacaggaaatcaatgcagcacgacctcagtgccctgtagggttcaacacactagcatttcctagtatgaagaggaaagacgttgtagatgaaaaacaaccatgggtatatctaaactgcggccatgtacatggctatcataactggggaaacaaagaagaacgtgatggaaaagatcgtgaatgtcctatgtgtaggtctgttggtccctatgttcctctgtggcttggatgtgaagctggattttatgtggacgccggccctccaacccatgcgtttagcccgtgtgggcatgtgtgttcagaaaagacaactgcctattggtcccagatcccacttcctcatggtactcatacttttcatgcagcctgtcccttttgtgcacatcagttggctggtgaacaaggctacatcagacttatttttcaaggacctctagactaa
Sequence Length
1257
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,286 Da
NCBI Official Full Name
Homo sapiens pellino homolog 1 (Drosophila), mRNA
UniProt Protein Name
E3 ubiquitin-protein ligase pellino homolog 1
UniProt Gene Name
PELI1
UniProt Synonym Gene Names
PRISM; Pellino-1
UniProt Entry Name
PELI1_HUMAN

Uniprot Description

PELI1: E3 ubiquitin ligase catalyzing the covalent attachment of ubiquitin moieties onto substrate proteins. Involved in the TLR and IL-1 signaling pathways via interaction with the complex containing IRAK kinases and TRAF6. Mediates 'Lys-63'-linked polyubiquitination of IRAK1 allowing subsequent NF-kappa-B activation. Found in a complex containing TRAF6, IRAK1 and IRAK4. Interacts with MAP3K7. Belongs to the pellino family.

Protein type: Ligase; Ubiquitin ligase; Ubiquitin conjugating system; Adaptor/scaffold; EC 6.3.2.19; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 2p13.3

Cellular Component: cytosol

Molecular Function: protein binding

Biological Process: positive regulation of I-kappaB kinase/NF-kappaB cascade

Similar Products

Product Notes

The PELI1 peli1 (Catalog #AAA1267289) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttttctc ctgatcaaga aaatcatcca tctaaagcac cagtaaaata tggtgaactc attgtcttag ggtataatgg gtctctccca aatggcgata gaggaaggag gaaaagtagg tttgctttgt ttaaaagacc taaggcaaat ggggtgaagc ccagcactgt gcatattgct tgtactcctc aggctgcaaa ggcaataagc aacaaagacc agcatagcat atcatatact ttgtctcggg cccagactgt ggtggttgaa tatactcatg acagcaacac agatatgttt cagattggcc ggtcgactga aagccccatt gattttgtag taactgacac ggttcctgga agtcaaagta attctgatac acagtcagta caaagcacta tatcaagatt tgcctgcaga atcatatgtg aacggaatcc tccctttaca gcacggattt atgctgcagg atttgactca tcaaaaaaca tctttcttgg ggagaaggct gccaaatgga agacatcaga tggacagatg gatggcttga ccactaatgg tgttcttgtg atgcatccac gcaatgggtt cacagaagac tccaagcctg gaatatggag agaaatatcg gtgtgtggaa atgtatttag cctacgtgaa accagatcgg ctcagcagag aggaaaaatg gtggaaattg aaaccaatca gttacaagat ggctcgttaa ttgacctctg tggtgcaaca ttgttatggc gtactgcaga aggcctttcc cacactccta ccgtgaagca tttagaagct ttaagacagg aaatcaatgc agcacgacct cagtgccctg tagggttcaa cacactagca tttcctagta tgaagaggaa agacgttgta gatgaaaaac aaccatgggt atatctaaac tgcggccatg tacatggcta tcataactgg ggaaacaaag aagaacgtga tggaaaagat cgtgaatgtc ctatgtgtag gtctgttggt ccctatgttc ctctgtggct tggatgtgaa gctggatttt atgtggacgc cggccctcca acccatgcgt ttagcccgtg tgggcatgtg tgttcagaaa agacaactgc ctattggtcc cagatcccac ttcctcatgg tactcatact tttcatgcag cctgtccctt ttgtgcacat cagttggctg gtgaacaagg ctacatcaga cttatttttc aaggacctct agactaa. It is sometimes possible for the material contained within the vial of "PELI1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.