Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PDGFRL cdna clone

PDGFRL cDNA Clone

Gene Names
PDGFRL; PDGRL; PRLTS
Synonyms
PDGFRL; PDGFRL cDNA Clone; PDGFRL cdna clone
Ordering
For Research Use Only!
Sequence
atgaaggtctggctgctgcttggtcttctgctggtgcacgaagcgctggaggatgttactggccaacaccttcccaagaacaagcgtccaaaagaaccaggagagaatagaatcaaacctaccaacaagaaggtgaagcccaaaattcctaaaatgaaggacagggactcagccaattcagcaccaaagacgcagtctatcatgatgcaagtgctggataaaggtcgcttccagaaacccgccgctaccctgagtctgctggcggggcaaactgtagagcttcgatgtaaagggagtagaattgggtggagctaccctgcgtatctggacacctttaaggattctcgcctcagcgtcaagcagaatgagcgctacggccagttgactctggtcaactccacctcggcagacacaggtgaattcagctgctgggtgcagctctgcagcggctacatctgcaggaaggacgaggccaaaacgggctccacctacatcttttttacagagaaaggagaactctttgtaccttctcccagctacttcgatgttgtctacttgaacccggacagacaggctgtggttccttgtcgggtgaccgtgctgtcggccaaagtcacgctccacagggaattcccagccaaggagatcccagccaatggaacggacattgtttatgacatgaagcggggctttgtgtatctgcaacctcattccgagcaccagggtgtggtttactgcagggcggaggccgggggcagatctcagatctccgtcaagtaccagctgctctacgtggcggttcccagtggccctccctcaacaaccatcttggcttcttcaaacaaagtgaaaagtggggacgacatcagtgtgctctgcactgtcctgggggagcccgatgtggaggtggagttcacctggatcttcccagggcagaaggatgaaaggcctgtgacgatccaagacacttggaggttgatccacagaggactgggacacaccacgagaatctcccagagtgtcattacagtggaagacttcgagacgattgatgcaggatattacatttgcactgctcagaatcttcaaggacagaccacagtagctaccactgttgagttttcctga
Sequence Length
1128
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,861 Da
NCBI Official Full Name
Homo sapiens platelet-derived growth factor receptor-like, mRNA
NCBI Official Synonym Full Names
platelet derived growth factor receptor like
NCBI Official Symbol
PDGFRL
NCBI Official Synonym Symbols
PDGRL; PRLTS
NCBI Protein Information
platelet-derived growth factor receptor-like protein
UniProt Protein Name
Platelet-derived growth factor receptor-like protein
UniProt Gene Name
PDGFRL
UniProt Synonym Gene Names
PRLTS; PDGFR-like protein
UniProt Entry Name
PGFRL_HUMAN

NCBI Description

This gene encodes a protein with significant sequence similarity to the ligand binding domain of platelet-derived growth factor receptor beta. Mutations in this gene, or deletion of a chromosomal segment containing this gene, are associated with sporadic hepatocellular carcinomas, colorectal cancers, and non-small cell lung cancers. This suggests this gene product may function as a tumor suppressor. [provided by RefSeq, Jul 2008]

Uniprot Description

PDGFRL: Defects in PDGFRL are associated with colorectal cancer (CRC).

Protein type: Secreted, signal peptide; Secreted; Receptor, misc.

Chromosomal Location of Human Ortholog: 8p22-p21.3

Molecular Function: platelet activating factor receptor activity; platelet-derived growth factor beta-receptor activity

Disease: Hepatocellular Carcinoma

Research Articles on PDGFRL

Similar Products

Product Notes

The PDGFRL pdgfrl (Catalog #AAA1272163) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggtct ggctgctgct tggtcttctg ctggtgcacg aagcgctgga ggatgttact ggccaacacc ttcccaagaa caagcgtcca aaagaaccag gagagaatag aatcaaacct accaacaaga aggtgaagcc caaaattcct aaaatgaagg acagggactc agccaattca gcaccaaaga cgcagtctat catgatgcaa gtgctggata aaggtcgctt ccagaaaccc gccgctaccc tgagtctgct ggcggggcaa actgtagagc ttcgatgtaa agggagtaga attgggtgga gctaccctgc gtatctggac acctttaagg attctcgcct cagcgtcaag cagaatgagc gctacggcca gttgactctg gtcaactcca cctcggcaga cacaggtgaa ttcagctgct gggtgcagct ctgcagcggc tacatctgca ggaaggacga ggccaaaacg ggctccacct acatcttttt tacagagaaa ggagaactct ttgtaccttc tcccagctac ttcgatgttg tctacttgaa cccggacaga caggctgtgg ttccttgtcg ggtgaccgtg ctgtcggcca aagtcacgct ccacagggaa ttcccagcca aggagatccc agccaatgga acggacattg tttatgacat gaagcggggc tttgtgtatc tgcaacctca ttccgagcac cagggtgtgg tttactgcag ggcggaggcc gggggcagat ctcagatctc cgtcaagtac cagctgctct acgtggcggt tcccagtggc cctccctcaa caaccatctt ggcttcttca aacaaagtga aaagtgggga cgacatcagt gtgctctgca ctgtcctggg ggagcccgat gtggaggtgg agttcacctg gatcttccca gggcagaagg atgaaaggcc tgtgacgatc caagacactt ggaggttgat ccacagagga ctgggacaca ccacgagaat ctcccagagt gtcattacag tggaagactt cgagacgatt gatgcaggat attacatttg cactgctcag aatcttcaag gacagaccac agtagctacc actgttgagt tttcctga. It is sometimes possible for the material contained within the vial of "PDGFRL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.