Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PDGFRA cdna clone

PDGFRA cDNA Clone

Gene Names
PDGFRA; GAS9; CD140A; PDGFR2; PDGFR-2; RHEPDGFRA
Synonyms
PDGFRA; PDGFRA cDNA Clone; PDGFRA cdna clone
Ordering
For Research Use Only!
Sequence
atggggacttcccatccggcgttcctggtcttaggctgtcttctcacagggctgagcctaatcctctgccagctttcattaccctctatccttccaaatgaaaatgaaaaggttgtgcagctgaattcatccttttctctgagatgctttggggagagtgaagtgagctggcagtaccccatgtctgaagaagagagctccgatgtggaaatcagaaatgaagaaaacaacagcggcctttttgtgacggtcttggaagtgagcagtgcctcggcggcccacacagggttgtacacttgctattacaaccacactcagacagaagagaatgagcttgaaggcaggcacatttacatctatgtgccagacccagatgtagcctttgtacctctaggaatgacggattatttagtcatcgtggaggatgatgattctgccattataccttgtcgcacaactgatcccgagactcctgtaaccttacacaacagtgagggggtggtacctgcctcctacgacagcagacagggctttaatgggaccttcactgtagggccctatatctgtgaggccaccgtcaaaggaaagaagttccagaccatcccatttaatgtttatgctttaaaaggtacttgtatcatctccttccttctttaa
Sequence Length
657
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
82,809 Da
NCBI Official Full Name
Homo sapiens platelet-derived growth factor receptor, alpha polypeptide, mRNA
NCBI Official Synonym Full Names
platelet derived growth factor receptor alpha
NCBI Official Symbol
PDGFRA
NCBI Official Synonym Symbols
GAS9; CD140A; PDGFR2; PDGFR-2; RHEPDGFRA
NCBI Protein Information
platelet-derived growth factor receptor alpha
UniProt Protein Name
Platelet-derived growth factor receptor alpha
UniProt Gene Name
PDGFRA
UniProt Synonym Gene Names
PDGFR2; RHEPDGFRA; PDGF-R-alpha; PDGFR-alpha; PDGFR-2
UniProt Entry Name
PGFRA_HUMAN

NCBI Description

This gene encodes a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. These growth factors are mitogens for cells of mesenchymal origin. The identity of the growth factor bound to a receptor monomer determines whether the functional receptor is a homodimer or a heterodimer, composed of both platelet-derived growth factor receptor alpha and beta polypeptides. Studies suggest that this gene plays a role in organ development, wound healing, and tumor progression. Mutations in this gene have been associated with idiopathic hypereosinophilic syndrome, somatic and familial gastrointestinal stromal tumors, and a variety of other cancers. [provided by RefSeq, Mar 2012]

Uniprot Description

PDGFRA: a receptor tyrosine kinase of the PDGFR family that binds members of the platelet-derived growth factor family. The identity of the growth factor bound determines whether the functional receptor is a homodimer or a heterodimer, composed of both PDGFR-alpha and -beta. Ligand binding induces receptor dimerization and autophosphorylation. Particularly important for kidney development since mice heterozygous for the receptor exhibit defective kidney phenotypes. Chromosomal rearrangments activate PDGFRalpha by fusion to BCR, causing atypical chronic myelogenous leukemia (CML), and to FIP1L1, causing idiopathic hypereosinophilic syndrome. Activating point mutations cause a minority of gastrointestinal stromal tumors (GIST). Promoter polymorphisms linked to neural tube defects including spina bifida, verified by mouse mutant model. Inhibitors: Gleevec, Sutent. OMIM: Two alternatively-spliced isoforms have been described.

Protein type: Membrane protein, integral; Kinase, protein; Oncoprotein; Protein kinase, TK; EC 2.7.10.1; Protein kinase, tyrosine (receptor); TK group; PDGFR family

Chromosomal Location of Human Ortholog: 4q12

Cellular Component: cytoplasm; integral to plasma membrane; intrinsic to plasma membrane; membrane; nucleus; plasma membrane; protein complex

Molecular Function: phosphatidylinositol-4,5-bisphosphate 3-kinase activity; platelet-derived growth factor alpha-receptor activity; platelet-derived growth factor binding; platelet-derived growth factor receptor binding; protein binding; protein homodimerization activity; protein kinase activity; Ras guanyl-nucleotide exchange factor activity; transmembrane receptor protein tyrosine kinase activity; vascular endothelial growth factor receptor activity

Biological Process: cardiac myofibril assembly; cell activation; elevation of cytosolic calcium ion concentration; embryonic cranial skeleton morphogenesis; embryonic digestive tract morphogenesis; embryonic skeletal morphogenesis; luteinization; MAPKKK cascade; peptidyl-tyrosine phosphorylation; phosphoinositide-mediated signaling; platelet-derived growth factor receptor signaling pathway; positive regulation of cell migration; positive regulation of cell proliferation; positive regulation of DNA replication; positive regulation of fibroblast proliferation; positive regulation of phosphoinositide 3-kinase activity; positive regulation of phosphoinositide 3-kinase cascade; protein amino acid autophosphorylation; regulation of chemotaxis; regulation of phosphoinositide 3-kinase cascade; wound healing

Disease: Gastrointestinal Stromal Tumor; Hypereosinophilic Syndrome, Idiopathic

Research Articles on PDGFRA

Similar Products

Product Notes

The PDGFRA pdgfra (Catalog #AAA1269883) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggactt cccatccggc gttcctggtc ttaggctgtc ttctcacagg gctgagccta atcctctgcc agctttcatt accctctatc cttccaaatg aaaatgaaaa ggttgtgcag ctgaattcat ccttttctct gagatgcttt ggggagagtg aagtgagctg gcagtacccc atgtctgaag aagagagctc cgatgtggaa atcagaaatg aagaaaacaa cagcggcctt tttgtgacgg tcttggaagt gagcagtgcc tcggcggccc acacagggtt gtacacttgc tattacaacc acactcagac agaagagaat gagcttgaag gcaggcacat ttacatctat gtgccagacc cagatgtagc ctttgtacct ctaggaatga cggattattt agtcatcgtg gaggatgatg attctgccat tataccttgt cgcacaactg atcccgagac tcctgtaacc ttacacaaca gtgagggggt ggtacctgcc tcctacgaca gcagacaggg ctttaatggg accttcactg tagggcccta tatctgtgag gccaccgtca aaggaaagaa gttccagacc atcccattta atgtttatgc tttaaaaggt acttgtatca tctccttcct tctttaa. It is sometimes possible for the material contained within the vial of "PDGFRA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.