PCDHGB4 cdna clone
PCDHGB4 cDNA Clone
Gene Names
PCDHGB4; FIB2; CDH20; PCDH-GAMMA-B4
Synonyms
PCDHGB4; PCDHGB4 cDNA Clone; PCDHGB4 cdna clone
Sequence
atggggagcggcgccggggagctgggccgggctgagaggctgccagtgctctttctcttcctgctgtctttgttctgcccggcgctctgtgagcagatccgctacaggattcccgaggaaatgcccaagggctccgtagtggggaacctcgccacggacctggggttcagcgtccaggagttaccgactcgaaaactgcgcgtcagttcggagaagccttacttcaccgtgagcgcagagagcggggagttgcttgtgagcagcaggctagacagggaggagatatgcgggaagaagccagcttgtgctctggaatttgaggctgttgctgaaaatccactgaacttttatcacgtgaatgtggagatcgaggacattaatgaccacacgccaaaattcacgcaaaattcctttgagctgcaaataagtgagtctgcacagcctggcacacgatttatattaggatctgcccatgatgcggatattggtagcaacacactgcagaattaccaactcagtcccagtgatcatttctcactgataaataaagagaaatcagatggcagtaaataccctgagatggtattgaagacacctttggacagagaaaagcagaaatcctaccacttgactttgactgccttggactttggagctccacccctaagcagcactgcacagatacacgttctagtgactgatgccaatgataatgctccagtgttcagtcaagacgtatacagggtgagcctttcagaaaacgtgtacccggggaccacggtgctacaggtgactgccacggaccaggatgagggtgtcaatgccgagattactttctctttcagtgaagctagccagatcacccaatttgacctgaactctaacaccggggaaattactgttttaaatacattagattttgaagaagtcaaagaatattccatagttttggaagcaagggacggtggaggaatgattgcgcaatgcacagtggaggtagaagtcatagatgaaaatgacaacgccccagaagtgatattccagtctctacccaacctaattatggaggacgccgagctgggaacacatattgctttgctcaaagtccgtgacaaggattccagacacaatggagaagtgacttgtaaattggaaggtgatgttccatttaaaatattaacttcttcaagaaacacgtataaattagtgacagatgctgttctagaccgcgagcagaatccagagtacaatataaccgttacggcaacagatcggggcaagcctcccctctcctccagttccagcatcaccctgcacattggtgatgtaaatgacaacgctccggttttctcacagtcttcctatatagtccacgtggccgagaacaacccgcctggagcctctatttcacaagtcagggcttctgatccggacttggggcccaacggccaagtctcttactgcatcatggccagtgacctggagcagcgggagctgtcatcctacgtgtccataagcgcggagagcggggtggtgttcgcgcagcgcgccttcgaccacgagcagctgcgcgccttcgaactcacactgcaggcccgcgaccagggctcgccagcgctcagcgcgaacgtgagcctgcgcgtgttagtggacgaccgcaacgacaatgcgccacgggtgctgtaccccgcgctgggtcccgacggctctgcgctcttcgatatggtgccgcacgctgcagagcctggctacttggtgaccaaggtagtggcggtggacgcagactcaggacacaacgcctggctgtcctaccacgtgctgcaggctagcgagcccgggctcttcagcctggggctgcgcacgggcgaagtgcgcacagcgcgtgccttaggcgacagggacgccgtccgccagcgccttctggtcgccgtgcgtgacggtggacagccaccactctcggccactgccacgttgcacctggtcttcgccgacagcttgcaggaggtgctgccggatatcactgaccgccccgacccctctgacctccaggctgagctgcagttttacctagtggtggccttggccttgatctcagtgctcttcctcgtggccatgattctggccattgccttgcgcctgcgacgctcctccagccccgcctcctggagctgcttccagcctggtctctgtgttaaatccgaatccgtggttccccccaactacagcgaggggactttgccttattcctacaatctatgtgttgcacatacaggaaagacggagtttaatttcctaaaatgtagtgagcagttgagttcaggacaagacatactttgcggtgattcatctggggccttatttccactttgtaattccagtgaattgacttcccatcaggtgagtttcctttaa
Sequence Length
2412
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
87,447 Da
NCBI Official Full Name
Homo sapiens protocadherin gamma subfamily B, 4, mRNA
NCBI Official Synonym Full Names
protocadherin gamma subfamily B, 4
NCBI Official Symbol
PCDHGB4
NCBI Official Synonym Symbols
FIB2; CDH20; PCDH-GAMMA-B4
NCBI Protein Information
protocadherin gamma-B4
UniProt Protein Name
Protocadherin gamma-B4
Protein Family
UniProt Gene Name
PCDHGB4
UniProt Synonym Gene Names
CDH20; FIB2; PCDH-gamma-B4
UniProt Entry Name
PCDGG_HUMAN
NCBI Description
This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. This particular family member is expressed in fibroblasts and is thought to play a role in wound healing in response to injury. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Uniprot Description
PCDHGB4: Potential calcium-dependent cell-adhesion protein. May be involved in the establishment and maintenance of specific neuronal connections in the brain. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Motility/polarity/chemotaxis; Cell adhesion
Chromosomal Location of Human Ortholog: 5q31
Biological Process: cell adhesion
Similar Products
Product Notes
The PCDHGB4 pcdhgb4 (Catalog #AAA1270236) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggagcg gcgccgggga gctgggccgg gctgagaggc tgccagtgct ctttctcttc ctgctgtctt tgttctgccc ggcgctctgt gagcagatcc gctacaggat tcccgaggaa atgcccaagg gctccgtagt ggggaacctc gccacggacc tggggttcag cgtccaggag ttaccgactc gaaaactgcg cgtcagttcg gagaagcctt acttcaccgt gagcgcagag agcggggagt tgcttgtgag cagcaggcta gacagggagg agatatgcgg gaagaagcca gcttgtgctc tggaatttga ggctgttgct gaaaatccac tgaactttta tcacgtgaat gtggagatcg aggacattaa tgaccacacg ccaaaattca cgcaaaattc ctttgagctg caaataagtg agtctgcaca gcctggcaca cgatttatat taggatctgc ccatgatgcg gatattggta gcaacacact gcagaattac caactcagtc ccagtgatca tttctcactg ataaataaag agaaatcaga tggcagtaaa taccctgaga tggtattgaa gacacctttg gacagagaaa agcagaaatc ctaccacttg actttgactg ccttggactt tggagctcca cccctaagca gcactgcaca gatacacgtt ctagtgactg atgccaatga taatgctcca gtgttcagtc aagacgtata cagggtgagc ctttcagaaa acgtgtaccc ggggaccacg gtgctacagg tgactgccac ggaccaggat gagggtgtca atgccgagat tactttctct ttcagtgaag ctagccagat cacccaattt gacctgaact ctaacaccgg ggaaattact gttttaaata cattagattt tgaagaagtc aaagaatatt ccatagtttt ggaagcaagg gacggtggag gaatgattgc gcaatgcaca gtggaggtag aagtcataga tgaaaatgac aacgccccag aagtgatatt ccagtctcta cccaacctaa ttatggagga cgccgagctg ggaacacata ttgctttgct caaagtccgt gacaaggatt ccagacacaa tggagaagtg acttgtaaat tggaaggtga tgttccattt aaaatattaa cttcttcaag aaacacgtat aaattagtga cagatgctgt tctagaccgc gagcagaatc cagagtacaa tataaccgtt acggcaacag atcggggcaa gcctcccctc tcctccagtt ccagcatcac cctgcacatt ggtgatgtaa atgacaacgc tccggttttc tcacagtctt cctatatagt ccacgtggcc gagaacaacc cgcctggagc ctctatttca caagtcaggg cttctgatcc ggacttgggg cccaacggcc aagtctctta ctgcatcatg gccagtgacc tggagcagcg ggagctgtca tcctacgtgt ccataagcgc ggagagcggg gtggtgttcg cgcagcgcgc cttcgaccac gagcagctgc gcgccttcga actcacactg caggcccgcg accagggctc gccagcgctc agcgcgaacg tgagcctgcg cgtgttagtg gacgaccgca acgacaatgc gccacgggtg ctgtaccccg cgctgggtcc cgacggctct gcgctcttcg atatggtgcc gcacgctgca gagcctggct acttggtgac caaggtagtg gcggtggacg cagactcagg acacaacgcc tggctgtcct accacgtgct gcaggctagc gagcccgggc tcttcagcct ggggctgcgc acgggcgaag tgcgcacagc gcgtgcctta ggcgacaggg acgccgtccg ccagcgcctt ctggtcgccg tgcgtgacgg tggacagcca ccactctcgg ccactgccac gttgcacctg gtcttcgccg acagcttgca ggaggtgctg ccggatatca ctgaccgccc cgacccctct gacctccagg ctgagctgca gttttaccta gtggtggcct tggccttgat ctcagtgctc ttcctcgtgg ccatgattct ggccattgcc ttgcgcctgc gacgctcctc cagccccgcc tcctggagct gcttccagcc tggtctctgt gttaaatccg aatccgtggt tccccccaac tacagcgagg ggactttgcc ttattcctac aatctatgtg ttgcacatac aggaaagacg gagtttaatt tcctaaaatg tagtgagcag ttgagttcag gacaagacat actttgcggt gattcatctg gggccttatt tccactttgt aattccagtg aattgacttc ccatcaggtg agtttccttt aa. It is sometimes possible for the material contained within the vial of "PCDHGB4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
