Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PCBP2 cdna clone

PCBP2 cDNA Clone

Gene Names
PCBP2; HNRPE2; hnRNP-E2
Synonyms
PCBP2; PCBP2 cDNA Clone; PCBP2 cdna clone
Ordering
For Research Use Only!
Sequence
atggacaccggtgtgattgaaggtggattaaatgtcactctcaccatccggctacttatgcatggaaaggaagttggcagtatcatcggaaagaaaggagaatcagttaagaagatgcgcgaggagagtggtgcacgtatcaacatctcagaagggaattgtcctgagagaattatcactttggctggacccactaatgccatcttcaaagcctttgctatgatcattgacaaactggaagaggacataagcagctctatgaccaatagcacagctgccagtagacccccggtcaccctgaggctggtggtccctgctagtcagtgtggctctctcattggaaaaggtggatgcaagatcaaggaaatacgagagagtacaggggctcaggtccaggtggcaggggatatgctacccaactcaactgagcgggccatcactattgctggcattccacaatccatcattgagtgtgtcaaacagatctgcgtggtcatgttggagtcccccccgaagggcgtgaccatcccgtaccggcccaagccgtccagctctccggtcatctttgcaggtggtcaggacaggtacagcacaggcagcgacagtgcgagctttccccacaccaccccgtccatgtgcctcaaccctgacctggagggaccacctctagaggcctataccattcaaggacagtatgccattccacagccagatttgaccaagctgcaccagttggcaatgcaacagtctcattttcccatgacgcatggcaacaccggattcagtggcattgaatccagctctccagaggtgaaaggctattgggcaggtttggatgcatctgctcagactacttctcatgaactcaccattccaaacgatttgattggctgcataatcgggcgtcaaggcgccaaaatcaatgagatccgtcagatgtctggggcgcagatcaaaattgcgaacccagtggaaggatctactgataggcaggttaccatcactggatctgctgccagcattagcctggctcaatatctaatcaatgtcaggctttcctcggagacgggtggcatggggagcagctag
Sequence Length
1089
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
UniProt Accession #
Molecular Weight
38,580 Da
NCBI Official Full Name
Homo sapiens poly(rC) binding protein 2, mRNA
NCBI Official Synonym Full Names
poly(rC) binding protein 2
NCBI Official Symbol
PCBP2
NCBI Official Synonym Symbols
HNRPE2; hnRNP-E2
NCBI Protein Information
poly(rC)-binding protein 2; poly(rC)-binding protein 2; hnRNP E2; alpha-CP2; heterogenous nuclear ribonucleoprotein E2; heterogeneous nuclear ribonucleoprotein E2
UniProt Protein Name
Poly(rC)-binding protein 2
Protein Family
UniProt Gene Name
PCBP2
UniProt Synonym Gene Names
hnRNP E2
UniProt Entry Name
PCBP2_HUMAN

NCBI Description

The protein encoded by this gene appears to be multifunctional. Along with PCBP-1 and hnRNPK, it is one of the major cellular poly(rC)-binding proteins. The encoded protein contains three K-homologous (KH) domains which may be involved in RNA binding. Together with PCBP-1, this protein also functions as a translational coactivator of poliovirus RNA via a sequence-specific interaction with stem-loop IV of the IRES, promoting poliovirus RNA replication by binding to its 5'-terminal cloverleaf structure. It has also been implicated in translational control of the 15-lipoxygenase mRNA, human papillomavirus type 16 L2 mRNA, and hepatitis A virus RNA. The encoded protein is also suggested to play a part in formation of a sequence-specific alpha-globin mRNP complex which is associated with alpha-globin mRNA stability. This multiexon structural mRNA is thought to be retrotransposed to generate PCBP-1, an intronless gene with functions similar to that of PCBP2. This gene and PCBP-1 have paralogous genes (PCBP3 and PCBP4) which are thought to have arisen as a result of duplication events of entire genes. Thsi gene also has two processed pseudogenes (PCBP2P1 and PCBP2P2). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

hnRNP E2: Single-stranded nucleic acid binding protein that binds preferentially to oligo dC. Major cellular poly(rC)-binding protein. Binds also poly(rU). Negatively regulates cellular antiviral responses mediated by MAVS signaling. It acts as an adapter between MAVS and the E3 ubiquitin ligase ITCH, therefore triggering MAVS ubiquitinationa and degradation. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA-binding; RNA splicing

Chromosomal Location of Human Ortholog: 12q13.13

Cellular Component: nucleoplasm; focal adhesion; membrane; cytoplasm; nucleus; ribonucleoprotein complex; cytosol

Molecular Function: protein binding; enzyme binding; DNA binding; RNA binding; ubiquitin protein ligase binding

Biological Process: nuclear mRNA splicing, via spliceosome; proteasomal ubiquitin-dependent protein catabolic process; RNA splicing; innate immune response; gene expression; negative regulation of defense response to virus; defense response to virus; negative regulation of interferon type I production; mRNA metabolic process

Research Articles on PCBP2

Similar Products

Product Notes

The PCBP2 pcbp2 (Catalog #AAA1273120) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacaccg gtgtgattga aggtggatta aatgtcactc tcaccatccg gctacttatg catggaaagg aagttggcag tatcatcgga aagaaaggag aatcagttaa gaagatgcgc gaggagagtg gtgcacgtat caacatctca gaagggaatt gtcctgagag aattatcact ttggctggac ccactaatgc catcttcaaa gcctttgcta tgatcattga caaactggaa gaggacataa gcagctctat gaccaatagc acagctgcca gtagaccccc ggtcaccctg aggctggtgg tccctgctag tcagtgtggc tctctcattg gaaaaggtgg atgcaagatc aaggaaatac gagagagtac aggggctcag gtccaggtgg caggggatat gctacccaac tcaactgagc gggccatcac tattgctggc attccacaat ccatcattga gtgtgtcaaa cagatctgcg tggtcatgtt ggagtccccc ccgaagggcg tgaccatccc gtaccggccc aagccgtcca gctctccggt catctttgca ggtggtcagg acaggtacag cacaggcagc gacagtgcga gctttcccca caccaccccg tccatgtgcc tcaaccctga cctggaggga ccacctctag aggcctatac cattcaagga cagtatgcca ttccacagcc agatttgacc aagctgcacc agttggcaat gcaacagtct cattttccca tgacgcatgg caacaccgga ttcagtggca ttgaatccag ctctccagag gtgaaaggct attgggcagg tttggatgca tctgctcaga ctacttctca tgaactcacc attccaaacg atttgattgg ctgcataatc gggcgtcaag gcgccaaaat caatgagatc cgtcagatgt ctggggcgca gatcaaaatt gcgaacccag tggaaggatc tactgatagg caggttacca tcactggatc tgctgccagc attagcctgg ctcaatatct aatcaatgtc aggctttcct cggagacggg tggcatgggg agcagctag. It is sometimes possible for the material contained within the vial of "PCBP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.