Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PARL cdna clone

PARL cDNA Clone

Gene Names
PARL; PSARL; PSARL1; RHBDS1; PRO2207; PSENIP2
Synonyms
PARL; PARL cDNA Clone; PARL cdna clone
Ordering
For Research Use Only!
Sequence
atggcgtggcgaggctgggcgcagagaggctggggctgcggccaggcgtggggtgcgtcggtgggcggccgcagctgcgaggagctcactgcggtcctaaccccgccgcagctcctcggacgcaggtttaacttctttattcaacaaaaatgcggattcagaaaagcacccaggaaggttgaacctcgaagatcagacccagggacaagtggtgaagcatacaagagaagtgctttgattcctcctgtggaagaaacagtcttttatccttctccctatcctataaggagtctcataaaacctttattttttactgttgggtttacaggctgtgcatttggatcagctgctatttggcaatatgaatcactgaaatccagggtccagagttattttgatggtataaaagctgattggttggatagcataagaccacaaaaagaaggagacttcagaaaggagattaacaagtggtggaataacctaagtgatggccagcggactgtgacaggtattatagctgcaaatgtccttgtattctgtttatggagagtaccttctctgcagcggacaatgatcagatatttcacatcgaatccagcctcaaaggtcctttgttctccaatgttgctgtcaacattcagtcatttctccttatttcacatggcagcaaatatgtatgttttgtggagcttctcttccagcatagtgaacattctgggtcaagagcagttcatggcagtgtacctatctgcaggtgttatttccaattttgtcagttacgtgggtaaagttgccacaggaagatatggaccatcacttggtgcatctggtgccatcatgacagtcctcgcagctgtctgcactaagatcccagaagggaggcttgccattattttccttccgatgttcacgttcacagcagggaatgccctgaaagccattatcgccatggatacagcaggaatgatcctgggatggaaattttttgatcatgcggcacatcttgggggagctctttttggaatatggtatgttacttacggtcatgaactgatttggaagaacagggagccgctagtgaaaatctggcatgaaataaggactaatggccccaaaaaaggaggtggctctaagtaa
Sequence Length
1140
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,589 Da
NCBI Official Full Name
Homo sapiens presenilin associated, rhomboid-like, mRNA
NCBI Official Synonym Full Names
presenilin associated rhomboid like
NCBI Official Symbol
PARL
NCBI Official Synonym Symbols
PSARL; PSARL1; RHBDS1; PRO2207; PSENIP2
NCBI Protein Information
presenilins-associated rhomboid-like protein, mitochondrial
UniProt Protein Name
Presenilins-associated rhomboid-like protein, mitochondrial
UniProt Gene Name
PARL
UniProt Synonym Gene Names
PSARL; Pbeta
UniProt Entry Name
PARL_HUMAN

NCBI Description

This gene encodes a member of the rhomboid family of intramembrane serine proteases that is localized to the inner mitochondrial membrane. The encoded protein regulates mitochondrial remodeling and apoptosis through regulated substrate proteolysis. Proteolytic processing of the encoded protein results in the release of a small peptide, P-beta, which may transit to the nucleus. Mutations in this gene may be associated with Parkinson's disease. [provided by RefSeq, May 2016]

Uniprot Description

PSARL: a mitochondrial intramembrane protease that is associated with insulin resistance and type 2 diabetes. Induced in humans by caloric restriction. Required for the control of apoptosis during postnatal growth. Essential for proteolytic processing of an antiapoptotic form of OPA1 which prevents the release of mitochondrial cytochrome c in response to intrinsic apoptotic signals. Promotes changes in mitochondria morphology regulated by phosphorylation of P-beta domain. Induced in humans by caloric restriction. Interacts with PSEN1 and PSEN2. Binds OPA1. Two isoforms of the human protein are produced by alternative splicing.

Protein type: Protease; Apoptosis; EC 3.4.21.105; Membrane protein, multi-pass; Mitochondrial; Membrane protein, integral

Chromosomal Location of Human Ortholog: 3q27.1

Cellular Component: mitochondrial inner membrane; mitochondrion

Molecular Function: endopeptidase activity; protein binding; serine-type endopeptidase activity

Biological Process: membrane protein proteolysis; protein processing; proteolysis; regulation of proteolysis

Research Articles on PARL

Similar Products

Product Notes

The PARL parl (Catalog #AAA1272520) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtggc gaggctgggc gcagagaggc tggggctgcg gccaggcgtg gggtgcgtcg gtgggcggcc gcagctgcga ggagctcact gcggtcctaa ccccgccgca gctcctcgga cgcaggttta acttctttat tcaacaaaaa tgcggattca gaaaagcacc caggaaggtt gaacctcgaa gatcagaccc agggacaagt ggtgaagcat acaagagaag tgctttgatt cctcctgtgg aagaaacagt cttttatcct tctccctatc ctataaggag tctcataaaa cctttatttt ttactgttgg gtttacaggc tgtgcatttg gatcagctgc tatttggcaa tatgaatcac tgaaatccag ggtccagagt tattttgatg gtataaaagc tgattggttg gatagcataa gaccacaaaa agaaggagac ttcagaaagg agattaacaa gtggtggaat aacctaagtg atggccagcg gactgtgaca ggtattatag ctgcaaatgt ccttgtattc tgtttatgga gagtaccttc tctgcagcgg acaatgatca gatatttcac atcgaatcca gcctcaaagg tcctttgttc tccaatgttg ctgtcaacat tcagtcattt ctccttattt cacatggcag caaatatgta tgttttgtgg agcttctctt ccagcatagt gaacattctg ggtcaagagc agttcatggc agtgtaccta tctgcaggtg ttatttccaa ttttgtcagt tacgtgggta aagttgccac aggaagatat ggaccatcac ttggtgcatc tggtgccatc atgacagtcc tcgcagctgt ctgcactaag atcccagaag ggaggcttgc cattattttc cttccgatgt tcacgttcac agcagggaat gccctgaaag ccattatcgc catggataca gcaggaatga tcctgggatg gaaatttttt gatcatgcgg cacatcttgg gggagctctt tttggaatat ggtatgttac ttacggtcat gaactgattt ggaagaacag ggagccgcta gtgaaaatct ggcatgaaat aaggactaat ggccccaaaa aaggaggtgg ctctaagtaa. It is sometimes possible for the material contained within the vial of "PARL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.