Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PARD3 cdna clone

PARD3 cDNA Clone

Gene Names
PARD3; Baz; ASIP; PAR3; PARD-3; PARD3A; SE2-5T2; PPP1R118; SE2-5L16; SE2-5LT1; PAR3alpha
Synonyms
PARD3; PARD3 cDNA Clone; PARD3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaagccaagaagggaatgctgaagggcttgggagacatgttcaggtttggcaaacatcgaaaagatgacaagattgagaaaacgggtaaaataaaaatacaggaatcctttacatcagaagaggagaggatacgaatgaagcaggagcaggagaggattcaagccaaaactcgagaatttagggaacgacaagctcgagagcgtgactatgctgaaattcaagattttcatcggacatttggctgtgatgatgagttaatgtatgggggagtttcttcttatgaaggttccatggctctcaacgctagacctcagagcccacgagaagggcatatgatggatgctttgtatgcccaagtcaagaagccgcggaattccaaaccctcacctgtagacagtaacagatcaactcctagcaatcatgatcggatacagcgtctgaggcaagaatttcagcaagcaaagcaagatgaagatgtagaagatcgtcggcggacctatagttttgagcaaccctggccgaacgcacggccggcgacgcagagcgggcgacactcggtgtccgtggaggtgcagatgcagcggcagcggcaggaggagcgcgagagctcccagcaggcccagcgccagtacagctctctgcctcggcaaagcaggaaaaatgccagctcggtctcccaggactcttgggagcagaactactcccctggggaaggcttccagagtgccaaagagaaccccaggtactccagctaccaaggctccaggaacggctacctgggaggacatggcttcaacgccagggtcatgctggaaactcaggagctccttcgccaggaacagaggcggaaggagcagcagatgaagaagcagcctccttccgaggggcccagcaactatgactcgtataagaaagtccaggaccccagttacgcccctcccaaggggcccttccggcaagatgtgcccccctccccttctcaggttgcgaggctgaacagacttcagactcctgagaaagggaggcccttctattcctga
Sequence Length
1044
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
149,695 Da
NCBI Official Full Name
Homo sapiens par-3 partitioning defective 3 homolog (C. elegans), mRNA
NCBI Official Synonym Full Names
par-3 family cell polarity regulator
NCBI Official Symbol
PARD3
NCBI Official Synonym Symbols
Baz; ASIP; PAR3; PARD-3; PARD3A; SE2-5T2; PPP1R118; SE2-5L16; SE2-5LT1; PAR3alpha
NCBI Protein Information
partitioning defective 3 homolog
UniProt Protein Name
Partitioning defective 3 homolog
Protein Family
UniProt Gene Name
PARD3
UniProt Synonym Gene Names
PAR3; PAR3A; PAR-3; PARD-3; ASIP
UniProt Entry Name
PARD3_HUMAN

NCBI Description

This gene encodes a member of the PARD protein family. PARD family members interact with other PARD family members and other proteins; they affect asymmetrical cell division and direct polarized cell growth. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]

Uniprot Description

PAR3-alpha: an adapter protein involved in asymmetrical cell division, and cell polarization processes. Polarity complex proteins, including PARD3, are essential for PIP3-induced receptor tyrosine kinase recycling. Seems to play a central role in the formation of epithelial tight junctions. Targets the phosphatase PTEN to cell junctions. Association with PARD6B may prevent the interaction of PARD3 with JAM1, thereby preventing tight junction assembly. The PARD6-PARD3 complex links GTP-bound Rho small GTPases to atypical protein kinase C proteins. Required for establishment of neuronal polarity and normal axon formation in cultured hippocampal neurons. PDZ 1 domain modulates interactions with JAM1, PARD6A and PARD6B; PDZ 2 domain mediates interaction with membranes containing phosphoinositol lipids; PDZ 3 domain regulates interactions with PTEN (via C-terminus). Belongs to the PAR3 family. 10 isoforms of the human protein are produced by alternative splicing. Isoform 2, but not at least isoform 3 interacts with PRKCZ.

Protein type: Adaptor/scaffold; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 10p11.21

Cellular Component: cell junction; cytosol; intercellular junction; internode region of axon; plasma membrane; tight junction

Molecular Function: phosphatidylinositol 3-phosphate binding; phosphatidylinositol-3,4,5-triphosphate binding; phosphatidylinositol-4,5-bisphosphate binding; protein binding

Biological Process: asymmetric cell division; axonogenesis; establishment and/or maintenance of cell polarity; myelination in the peripheral nervous system; positive regulation of myelination; protein complex assembly; protein kinase C activation; protein targeting to membrane; transforming growth factor beta receptor signaling pathway

Research Articles on PARD3

Similar Products

Product Notes

The PARD3 pard3 (Catalog #AAA1269996) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaagcca agaagggaat gctgaagggc ttgggagaca tgttcaggtt tggcaaacat cgaaaagatg acaagattga gaaaacgggt aaaataaaaa tacaggaatc ctttacatca gaagaggaga ggatacgaat gaagcaggag caggagagga ttcaagccaa aactcgagaa tttagggaac gacaagctcg agagcgtgac tatgctgaaa ttcaagattt tcatcggaca tttggctgtg atgatgagtt aatgtatggg ggagtttctt cttatgaagg ttccatggct ctcaacgcta gacctcagag cccacgagaa gggcatatga tggatgcttt gtatgcccaa gtcaagaagc cgcggaattc caaaccctca cctgtagaca gtaacagatc aactcctagc aatcatgatc ggatacagcg tctgaggcaa gaatttcagc aagcaaagca agatgaagat gtagaagatc gtcggcggac ctatagtttt gagcaaccct ggccgaacgc acggccggcg acgcagagcg ggcgacactc ggtgtccgtg gaggtgcaga tgcagcggca gcggcaggag gagcgcgaga gctcccagca ggcccagcgc cagtacagct ctctgcctcg gcaaagcagg aaaaatgcca gctcggtctc ccaggactct tgggagcaga actactcccc tggggaaggc ttccagagtg ccaaagagaa ccccaggtac tccagctacc aaggctccag gaacggctac ctgggaggac atggcttcaa cgccagggtc atgctggaaa ctcaggagct ccttcgccag gaacagaggc ggaaggagca gcagatgaag aagcagcctc cttccgaggg gcccagcaac tatgactcgt ataagaaagt ccaggacccc agttacgccc ctcccaaggg gcccttccgg caagatgtgc ccccctcccc ttctcaggtt gcgaggctga acagacttca gactcctgag aaagggaggc ccttctattc ctga. It is sometimes possible for the material contained within the vial of "PARD3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.