PACSIN3 cdna clone
PACSIN3 cDNA Clone
Gene Names
PACSIN3; SDPIII
Synonyms
PACSIN3; PACSIN3 cDNA Clone; PACSIN3 cdna clone
Sequence
atggctccagaagaggacgctggaggggaggccttagggggcagtttctgggaggctggcaactacaggcgcacggtacagcgggtggaggacgggcaccggctgtgcggggacctggtcagctgcttccaggagcgcgcccgcatcgagaaggcttatgcccagcagttggctgactgggcccgaaagtggagggggaccgtggagaagggcccccagtatggcacactggagaaggcctggcatgcctttttcacggcggctgagcggctgagcgcgctgcacctggaggtgcgggagaagctgcaagggcaggacagtgagcgggtgcgcgcctggcagcggggggctttccaccggcctgtgctgggcggcttccgcgagagccgggcggccgaggacggcttccgcaaggcccagaagccctggctgaagaggctgaaggaggttgaggcttccaagaaaagctaccacgcagcccggaaggatgagaagaccgcccagacgagggagagccacgcaaaggcagacagcgccgtctcccaggagcagctgcgcaaactgcaggaacgggtggaacgctgtgccaaggaggccgagaagacaaaagctcagtatgagcagacgctggcagagctgcatcgctacactccacgctacatggaggacatggaacaggcctttgagacctgccaggccgccgagcgccagcggcttcttttcttcaaggatatgctgctcaccttacaccagcacctggacctttccagcagtgagaagttccatgaactccaccgtgacttgcaccagggcattgaggcagccagtgacgaagaggatctgcgctggtggcgcagcacccacgggccaggcatggccatgaactggccacagttcgaggagtggtccttggacacacagaggacaatcagccggaaagagaagggtggccggagccctgatgaggttaccctgaccagcattgtgcctacaagagatggcaccgcacccccaccccagtccccggggtccccaggcacggggcaggatgaggagtggtcagatgaagagagtccccggaaggctgccaccggggttcgggtgagggcactctatgactacgctggccaggaagctgatgagctgagcttccgagcaggggaggagctgctgaagatgagtgaggaggacgagcagggctggtgccaaggccagttgcagagtggccgcattggcctgtaccctgccaactacgtggagtgtgtgggcgcctga
Sequence Length
1275
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
48,487 Da
NCBI Official Full Name
Homo sapiens protein kinase C and casein kinase substrate in neurons 3, mRNA
NCBI Official Synonym Full Names
protein kinase C and casein kinase substrate in neurons 3
NCBI Official Symbol
PACSIN3
NCBI Official Synonym Symbols
SDPIII
NCBI Protein Information
protein kinase C and casein kinase substrate in neurons protein 3
UniProt Protein Name
Protein kinase C and casein kinase substrate in neurons protein 3
Protein Family
UniProt Gene Name
PACSIN3
UniProt Entry Name
PACN3_HUMAN
NCBI Description
This gene is a member of the protein kinase C and casein kinase substrate in neurons family. The encoded protein is involved in linking the actin cytoskeleton with vesicle formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Uniprot Description
PACSIN3: May play a role in vesicle formation and transport. Belongs to the PACSIN family.
Protein type: Vesicle; Adaptor/scaffold
Chromosomal Location of Human Ortholog: 11p12-p11.12
Cellular Component: cytoplasm; endosome; nucleoplasm; plasma membrane
Molecular Function: calcium channel inhibitor activity; cytoskeletal protein binding; lipid binding; protein binding
Biological Process: negative regulation of calcium ion transport; negative regulation of endocytosis; positive regulation of membrane protein ectodomain proteolysis; regulation of endocytosis
Research Articles on PACSIN3
Similar Products
Product Notes
The PACSIN3 pacsin3 (Catalog #AAA1267361) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctccag aagaggacgc tggaggggag gccttagggg gcagtttctg ggaggctggc aactacaggc gcacggtaca gcgggtggag gacgggcacc ggctgtgcgg ggacctggtc agctgcttcc aggagcgcgc ccgcatcgag aaggcttatg cccagcagtt ggctgactgg gcccgaaagt ggagggggac cgtggagaag ggcccccagt atggcacact ggagaaggcc tggcatgcct ttttcacggc ggctgagcgg ctgagcgcgc tgcacctgga ggtgcgggag aagctgcaag ggcaggacag tgagcgggtg cgcgcctggc agcggggggc tttccaccgg cctgtgctgg gcggcttccg cgagagccgg gcggccgagg acggcttccg caaggcccag aagccctggc tgaagaggct gaaggaggtt gaggcttcca agaaaagcta ccacgcagcc cggaaggatg agaagaccgc ccagacgagg gagagccacg caaaggcaga cagcgccgtc tcccaggagc agctgcgcaa actgcaggaa cgggtggaac gctgtgccaa ggaggccgag aagacaaaag ctcagtatga gcagacgctg gcagagctgc atcgctacac tccacgctac atggaggaca tggaacaggc ctttgagacc tgccaggccg ccgagcgcca gcggcttctt ttcttcaagg atatgctgct caccttacac cagcacctgg acctttccag cagtgagaag ttccatgaac tccaccgtga cttgcaccag ggcattgagg cagccagtga cgaagaggat ctgcgctggt ggcgcagcac ccacgggcca ggcatggcca tgaactggcc acagttcgag gagtggtcct tggacacaca gaggacaatc agccggaaag agaagggtgg ccggagccct gatgaggtta ccctgaccag cattgtgcct acaagagatg gcaccgcacc cccaccccag tccccggggt ccccaggcac ggggcaggat gaggagtggt cagatgaaga gagtccccgg aaggctgcca ccggggttcg ggtgagggca ctctatgact acgctggcca ggaagctgat gagctgagct tccgagcagg ggaggagctg ctgaagatga gtgaggagga cgagcagggc tggtgccaag gccagttgca gagtggccgc attggcctgt accctgccaa ctacgtggag tgtgtgggcg cctga. It is sometimes possible for the material contained within the vial of "PACSIN3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
