PACSIN1 cdna clone
PACSIN1 cDNA Clone
Gene Names
PACSIN1; SDPI
Synonyms
PACSIN1; PACSIN1 cDNA Clone; PACSIN1 cdna clone
Sequence
atgtccagctcctacgatgaggcctcactggcgccagaggagaccaccgacagcttctgggaggtggggaactacaagcggaccgtgaagcgcatcgatgacggccaccgtctatgcaacgacctgatgaactgcgtgcaggagcgcgccaagatcgagaaggcgtacgggcagcagctcaccgactgggccaagcgttggcgccagctcatcgagaaaggcccacagtatggcagcctggagcgggcctggggtgccataatgacagaggcagacaaggtgagcgagctgcaccaggaggtgaagaacaatctgctgaatgaggacctggagaaggtgaagaactggcagaaggacgcctatcacaagcagatcatgggtggcttcaaggagacgaaggaggctgaagatggcttccgcaaggcccagaagccttgggccaagaagatgaaggagctggaggcagccaagaaggcctaccatttggcttgcaaagaggaaaagctggccatgacacgggagatgaacagcaagacggagcaatcggtcacacctgagcagcaaaagaagctgcaggacaaagtggacaagtgcaagcaggatgtgcagaagacacaggagaagtatgagaaagtgctggaagatgtgggcaagaccacaccccagtacatggagaacatggagcaggtgtttgagcaatgccagcaatttgaggaaaagcggctggtcttcctcaaggaggtgctgctggacatcaaacggcacctcaacctggctgagaacagcagctacatccatgtgtaccgtgagctggagcaggccatccggggggctgatgcccaggaagacctcagatggttccgcagcaccagtggccccggcatgcccatgaactggccccagtttgaggagtggaacccagaccttcctcacaccaccaccaagaaggagaaacagcctaagaaggcagagggagtggcgctgaccaatgccactggggcggtagagtccacatcccaggctggggaccgcggcagtgttagcagctacgacagaggccagccctacgccaccgagtggtcagacgacgagagtgggaacccctttgggggcagtgagaccaacgggggcgccaacccctttgaggacgactccaagggagtgcgcgtgcgggcactctacgactatgacggccaggagcaggacgagctcagctttaaggccggagacgaactcaccaagctgggcgaggaggatgagcagggctggtgccgtgggcggctggacagcgggcagctgggcctctaccctgccaactacgtggaggctatctag
Sequence Length
1335
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
50,966 Da
NCBI Official Full Name
Homo sapiens protein kinase C and casein kinase substrate in neurons 1, mRNA
NCBI Official Synonym Full Names
protein kinase C and casein kinase substrate in neurons 1
NCBI Official Symbol
PACSIN1
NCBI Official Synonym Symbols
SDPI
NCBI Protein Information
protein kinase C and casein kinase substrate in neurons protein 1
UniProt Protein Name
Protein kinase C and casein kinase substrate in neurons protein 1
UniProt Gene Name
PACSIN1
UniProt Synonym Gene Names
KIAA1379
UniProt Entry Name
PACN1_HUMAN
Uniprot Description
PACSIN1: May play a role in vesicle formation and transport. Belongs to the PACSIN family.
Protein type: Adaptor/scaffold
Chromosomal Location of Human Ortholog: 6p21.3
Cellular Component: cytoplasm; endosome; nerve terminal; perinuclear region of cytoplasm; plasma membrane; synapse
Molecular Function: phospholipid binding; protein binding
Biological Process: neurite morphogenesis; regulation of endocytosis; synaptic vesicle endocytosis
Research Articles on PACSIN1
Similar Products
Product Notes
The PACSIN1 pacsin1 (Catalog #AAA1270619) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccagct cctacgatga ggcctcactg gcgccagagg agaccaccga cagcttctgg gaggtgggga actacaagcg gaccgtgaag cgcatcgatg acggccaccg tctatgcaac gacctgatga actgcgtgca ggagcgcgcc aagatcgaga aggcgtacgg gcagcagctc accgactggg ccaagcgttg gcgccagctc atcgagaaag gcccacagta tggcagcctg gagcgggcct ggggtgccat aatgacagag gcagacaagg tgagcgagct gcaccaggag gtgaagaaca atctgctgaa tgaggacctg gagaaggtga agaactggca gaaggacgcc tatcacaagc agatcatggg tggcttcaag gagacgaagg aggctgaaga tggcttccgc aaggcccaga agccttgggc caagaagatg aaggagctgg aggcagccaa gaaggcctac catttggctt gcaaagagga aaagctggcc atgacacggg agatgaacag caagacggag caatcggtca cacctgagca gcaaaagaag ctgcaggaca aagtggacaa gtgcaagcag gatgtgcaga agacacagga gaagtatgag aaagtgctgg aagatgtggg caagaccaca ccccagtaca tggagaacat ggagcaggtg tttgagcaat gccagcaatt tgaggaaaag cggctggtct tcctcaagga ggtgctgctg gacatcaaac ggcacctcaa cctggctgag aacagcagct acatccatgt gtaccgtgag ctggagcagg ccatccgggg ggctgatgcc caggaagacc tcagatggtt ccgcagcacc agtggccccg gcatgcccat gaactggccc cagtttgagg agtggaaccc agaccttcct cacaccacca ccaagaagga gaaacagcct aagaaggcag agggagtggc gctgaccaat gccactgggg cggtagagtc cacatcccag gctggggacc gcggcagtgt tagcagctac gacagaggcc agccctacgc caccgagtgg tcagacgacg agagtgggaa cccctttggg ggcagtgaga ccaacggggg cgccaacccc tttgaggacg actccaaggg agtgcgcgtg cgggcactct acgactatga cggccaggag caggacgagc tcagctttaa ggccggagac gaactcacca agctgggcga ggaggatgag cagggctggt gccgtgggcg gctggacagc gggcagctgg gcctctaccc tgccaactac gtggaggcta tctag. It is sometimes possible for the material contained within the vial of "PACSIN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
