PABPC3 cdna clone
PABPC3 cDNA Clone
Gene Names
PABPC3; PABP3; tPABP; PABPL3
Synonyms
PABPC3; PABPC3 cDNA Clone; PABPC3 cdna clone
Sequence
atgaaccccagcacccccagctacccaacggcctcgctctacgtgggggacctccaccccgacgtgactgaggcgatgctctacgagaagttcagcccggcagggcccatcctctccatccggatctgcagggacttgatcaccagcggctcctccaactacgcgtatgtgaacttccagcatacgaaggacgcggagcatgctctggacaccatgaattttgatgttataaagggcaagccagtacgcatcatgtggtctcagcgtgatccatcacttcgaaaaagtggagtgggcaacatattcgttaaaaatctggataagtccattaataataaagcactgtatgatacagtttctgcttttggtaacatcctttcgtgtaacgtggtttgtgatgaaaatggttccaagggttatggatttgtacactttgagacacacgaagcagctgaaagagctattaaaaaaatgaacggaatgctcctaaatggtcgcaaagtatttgttggacaatttaagtctcgtaaagaacgagaagctgaacttggagctagggcaaaagagttccccaatgtttacatcaagaattttggagaagacatggatgatgagcgccttaaggatctctttggcaagttcgggcccgccttaagtgtgaaagtaatgaccgatgaaagtggaaaatccaaaggatttggatttgtaagctttgaaaggcatgaagatgcacagaaagctgtagatgagatgaatggaaaggagctcaatggaaaacaaatttacgttggtcgagctcagaaaaaagtggaacggcagacggaacttaagcgcacatttgaacagatgaagcaagataggatcaccagataccaggttgttaatctttatgtgaaaaatcttgatgatggtattgatgatgaacgtctccggaaagcgttttctccatttggtacaatcactagtgcaaaggttatgatggaaggtggtcgcagcaaagggtttggttttgtatgtttctcctccccagaagaagccactaaagcagttacagaaatgaacggtagaattgtggccacaaagccattgtatgtagctttagctcagcgcaaagaagagcgccaggcttacctcactaacgagtatatgcagagaatggcaagtgtacgagctgtgcccaaccagcgagcacctccttcaggttacttcatgacagctgtcccgcagactcagaaccatgctgcatactatcctcctagccaaattgctcgactaagaccaagtcctcgctggactgctcagggtgccagacctcatccattccaaaataagcccagtgctatccgcccaggtgctcctagagtaccatttagtactatgagaccagcttcttcacaggttccacgagtcatgtcaacgcagcgtgttgctaacacatcaacacagacagtgggtccacgtcctgcagctgctgctgctgctgcagctacccctgctgtgcgcacggttccacggtataaatatgctgcgggagttcgcaatcctcagcaacatcgtaatgcacagccacaagttacaatgcaacagcttgctgttcatgtacaaggtcaggaaactttgactgcctccaggttggcatctgcccctcctcaaaagcaaaagcaaatgttaggtgaacggctctttcctcttattcaagccatgcaccctactcttgctgggaaaatcactggcatgttgttggagattgataattcagaacttctttatatgctcgagtctccagagtcactccgttctaaggttgatgaagctgtagctgtactacaagcccaccaagctaaagaggctacccagaaagcagttaacagtgctaccggtgttccaactgtttaa
Sequence Length
1896
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
70,031 Da
NCBI Official Full Name
Homo sapiens poly(A) binding protein, cytoplasmic 3, mRNA
NCBI Official Synonym Full Names
poly(A) binding protein cytoplasmic 3
NCBI Official Symbol
PABPC3
NCBI Official Synonym Symbols
PABP3; tPABP; PABPL3
NCBI Protein Information
polyadenylate-binding protein 3
UniProt Protein Name
Polyadenylate-binding protein 3
UniProt Gene Name
PABPC3
UniProt Synonym Gene Names
PABP3; PABPL3; PABP-3; Poly(A)-binding protein 3
UniProt Entry Name
PABP3_HUMAN
NCBI Description
Messenger RNA stability and translation initiation are extensively under the control of poly(A)-binding proteins (PABP). See PABPC1 (MIM 604679) for background information.[supplied by OMIM, Jul 2002]
Uniprot Description
PABP 3: Binds the poly(A) tail of mRNA. May be involved in cytoplasmic regulatory processes of mRNA metabolism. Binds poly(A) with a slightly lower affinity as compared to PABPC1. Belongs to the polyadenylate-binding protein type-1 family.
Protein type: RNA-binding
Chromosomal Location of Human Ortholog: 13q12-q13
Molecular Function: poly(A) binding
Research Articles on PABPC3
Similar Products
Product Notes
The PABPC3 pabpc3 (Catalog #AAA1278315) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacccca gcacccccag ctacccaacg gcctcgctct acgtggggga cctccacccc gacgtgactg aggcgatgct ctacgagaag ttcagcccgg cagggcccat cctctccatc cggatctgca gggacttgat caccagcggc tcctccaact acgcgtatgt gaacttccag catacgaagg acgcggagca tgctctggac accatgaatt ttgatgttat aaagggcaag ccagtacgca tcatgtggtc tcagcgtgat ccatcacttc gaaaaagtgg agtgggcaac atattcgtta aaaatctgga taagtccatt aataataaag cactgtatga tacagtttct gcttttggta acatcctttc gtgtaacgtg gtttgtgatg aaaatggttc caagggttat ggatttgtac actttgagac acacgaagca gctgaaagag ctattaaaaa aatgaacgga atgctcctaa atggtcgcaa agtatttgtt ggacaattta agtctcgtaa agaacgagaa gctgaacttg gagctagggc aaaagagttc cccaatgttt acatcaagaa ttttggagaa gacatggatg atgagcgcct taaggatctc tttggcaagt tcgggcccgc cttaagtgtg aaagtaatga ccgatgaaag tggaaaatcc aaaggatttg gatttgtaag ctttgaaagg catgaagatg cacagaaagc tgtagatgag atgaatggaa aggagctcaa tggaaaacaa atttacgttg gtcgagctca gaaaaaagtg gaacggcaga cggaacttaa gcgcacattt gaacagatga agcaagatag gatcaccaga taccaggttg ttaatcttta tgtgaaaaat cttgatgatg gtattgatga tgaacgtctc cggaaagcgt tttctccatt tggtacaatc actagtgcaa aggttatgat ggaaggtggt cgcagcaaag ggtttggttt tgtatgtttc tcctccccag aagaagccac taaagcagtt acagaaatga acggtagaat tgtggccaca aagccattgt atgtagcttt agctcagcgc aaagaagagc gccaggctta cctcactaac gagtatatgc agagaatggc aagtgtacga gctgtgccca accagcgagc acctccttca ggttacttca tgacagctgt cccgcagact cagaaccatg ctgcatacta tcctcctagc caaattgctc gactaagacc aagtcctcgc tggactgctc agggtgccag acctcatcca ttccaaaata agcccagtgc tatccgccca ggtgctccta gagtaccatt tagtactatg agaccagctt cttcacaggt tccacgagtc atgtcaacgc agcgtgttgc taacacatca acacagacag tgggtccacg tcctgcagct gctgctgctg ctgcagctac ccctgctgtg cgcacggttc cacggtataa atatgctgcg ggagttcgca atcctcagca acatcgtaat gcacagccac aagttacaat gcaacagctt gctgttcatg tacaaggtca ggaaactttg actgcctcca ggttggcatc tgcccctcct caaaagcaaa agcaaatgtt aggtgaacgg ctctttcctc ttattcaagc catgcaccct actcttgctg ggaaaatcac tggcatgttg ttggagattg ataattcaga acttctttat atgctcgagt ctccagagtc actccgttct aaggttgatg aagctgtagc tgtactacaa gcccaccaag ctaaagaggc tacccagaaa gcagttaaca gtgctaccgg tgttccaact gtttaa. It is sometimes possible for the material contained within the vial of "PABPC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
