Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PABPC1 cdna clone

PABPC1 cDNA Clone

Gene Names
PABPC1; PAB1; PABP; PABP1; PABPC2; PABPL1
Synonyms
PABPC1; PABPC1 cDNA Clone; PABPC1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaccccagtgcccccagctaccccatggcctcgctctacgtgggggacctccaccccgacgtgaccgaggcgatgctctacgagaagttcagcccggccgggcccatcctctccatccgggtctgcagggacatgatcacccgccgctccttgggctacgcgtatgtgaacttccagcagccggcggacgcggagcgtgctttggacaccatgaattttgatgttataaagggcaagccagtacgcatcatgtggtctcagcgtgatccatcacttcgcaaaagtggagtaggcaacatattcattaaaaatctggacaaatccattgataataaagcactgtatgatacattttctgcttttggtaacatcctttcatgtaaggtggtttgtgatgaaaatggttccaagggctatggatttgtacactttgagacgcaggaagcagctgaaagagctattgaaaaaatgaatggaatgctcctaaatgatcgcaaagtatttgttggacgatttaagtctcgtaaagaacgagaagctgaacttggagctagggcaaaagaattcaccaatgtttacatcaagaattttggagaagacatggatgatgagcgccttaaggatctctttggcaagtttgggcctgccttaagtgtgaaagtaatgactgatgaaagtggaaaatccaaaggatttggatttgtaagctttgaaaggcatgaagatgcacagaaagctgtggatgagatgaacggaaaggagctcaatggaaaacaaatttatgttggtcgagctcagaaaaaggtggaacggcagacggaacttaagcgcaaatttgaacagatgaaacaagataggatcaccagataccagggtgttaatctttatgtgaaaaatcttgatgatggtattgatgatgaacgtctccggaaagagttttctccatttggtacaatcactagtgcaaaggttatgatggagggtggtcgcagcaaagggtttggttttgtatgtttctcctccccagaagaagccactaaagcagttacagaaatgaacggtagaattgtggccacaaagccattgtatgtagctttagctcagcgcaaagaagagcgccaggctcacctcactaaccagtatatgcagagaatggcaagtgtacgagctgttcccaaccctgtaatcaacccctaccagccagcacctccttcaggttacttcatggcagctatcccacagactcagaaccgtgctgcatactatcctcctagccaaattgctcaactaagaccaagtcctcgctggactgctcagggtgccagacctcatccattccaaaatatgcccggtgctatccgcccagctgctcctagaccaccatttagtactatgagaccagcttcttcacaggttccacgagtcatgtcaacacagcgtgttgctaacacatcaacacagacaatgggtccacgtcctgcagctgcagccgctgcagctactcctgctgtccgcaccgttccacagtataaatatgctgcaggagttcgcaatcctcagcaacatcttaatgcacagccacaagttacaatgcaacagcctgctgttcatgtacaaggtcaggaacctttgactgcttccatgttggcatctgcccctcctcaagagcaaaagcaaatgttgggtgaacggctgtttcctcttattcaagccatgcaccctactcttgctggtaaaatcactggcatgttgttggagattgataattcagaacttcttcatatgctcgagtctccagagtcactccgttctaaggttgatgaagctgtagctgtactacaagcccaccaagctaaagaggctgcccagaaagcagttaacagtgccaccggtgttccaactgtttaa
Sequence Length
1911
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
61,181 Da
NCBI Official Full Name
Homo sapiens poly(A) binding protein, cytoplasmic 1, mRNA
NCBI Official Synonym Full Names
poly(A) binding protein cytoplasmic 1
NCBI Official Symbol
PABPC1
NCBI Official Synonym Symbols
PAB1; PABP; PABP1; PABPC2; PABPL1
NCBI Protein Information
polyadenylate-binding protein 1
UniProt Protein Name
Polyadenylate-binding protein 1
UniProt Gene Name
PABPC1
UniProt Synonym Gene Names
PAB1; PABP1; PABPC2; PABP-1; Poly(A)-binding protein 1
UniProt Entry Name
PABP1_HUMAN

NCBI Description

This gene encodes a poly(A) binding protein. The protein shuttles between the nucleus and cytoplasm and binds to the 3' poly(A) tail of eukaryotic messenger RNAs via RNA-recognition motifs. The binding of this protein to poly(A) promotes ribosome recruitment and translation initiation; it is also required for poly(A) shortening which is the first step in mRNA decay. The gene is part of a small gene family including three protein-coding genes and several pseudogenes.[provided by RefSeq, Aug 2010]

Uniprot Description

PABP 1: poly(A) binding protein 1. May be involved in cytoplasmic regulatory processes of mRNA metabolism. Shuttles between the cytoplasm and the nucleus. Can probably bind to cytoplasmic RNA sequences other than poly(A) in vivo. May be involved in translationally coupled mRNA turnover. Implicated with other RNA-binding proteins in the cytoplasmic deadenylation/translational and decay interplay of the FOS mRNA mediated by the major coding-region determinant of instability (mCRD) domain. A potential substrate in MAPKAP kinase 2-induced mRNA stabilization. Two alternatively spliced isoforms have been described.

Protein type: Motility/polarity/chemotaxis; RNA splicing; RNA-binding; Spliceosome; Translation

Chromosomal Location of Human Ortholog: 8q22.2-q23

Cellular Component: cytoplasm; cytosol; focal adhesion; membrane; nucleus; ribonucleoprotein complex; stress granule

Molecular Function: mRNA 3'-UTR binding; poly(A) binding; poly(U) binding; protein binding; protein C-terminus binding; translation activator activity

Biological Process: mRNA catabolic process, nonsense-mediated decay; mRNA polyadenylation; mRNA stabilization; nuclear mRNA splicing, via spliceosome; poly(A) tail shortening; positive regulation of viral genome replication; regulation of mRNA stability; RNA-mediated gene silencing; translational initiation

Research Articles on PABPC1

Similar Products

Product Notes

The PABPC1 pabpc1 (Catalog #AAA1269352) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacccca gtgcccccag ctaccccatg gcctcgctct acgtggggga cctccacccc gacgtgaccg aggcgatgct ctacgagaag ttcagcccgg ccgggcccat cctctccatc cgggtctgca gggacatgat cacccgccgc tccttgggct acgcgtatgt gaacttccag cagccggcgg acgcggagcg tgctttggac accatgaatt ttgatgttat aaagggcaag ccagtacgca tcatgtggtc tcagcgtgat ccatcacttc gcaaaagtgg agtaggcaac atattcatta aaaatctgga caaatccatt gataataaag cactgtatga tacattttct gcttttggta acatcctttc atgtaaggtg gtttgtgatg aaaatggttc caagggctat ggatttgtac actttgagac gcaggaagca gctgaaagag ctattgaaaa aatgaatgga atgctcctaa atgatcgcaa agtatttgtt ggacgattta agtctcgtaa agaacgagaa gctgaacttg gagctagggc aaaagaattc accaatgttt acatcaagaa ttttggagaa gacatggatg atgagcgcct taaggatctc tttggcaagt ttgggcctgc cttaagtgtg aaagtaatga ctgatgaaag tggaaaatcc aaaggatttg gatttgtaag ctttgaaagg catgaagatg cacagaaagc tgtggatgag atgaacggaa aggagctcaa tggaaaacaa atttatgttg gtcgagctca gaaaaaggtg gaacggcaga cggaacttaa gcgcaaattt gaacagatga aacaagatag gatcaccaga taccagggtg ttaatcttta tgtgaaaaat cttgatgatg gtattgatga tgaacgtctc cggaaagagt tttctccatt tggtacaatc actagtgcaa aggttatgat ggagggtggt cgcagcaaag ggtttggttt tgtatgtttc tcctccccag aagaagccac taaagcagtt acagaaatga acggtagaat tgtggccaca aagccattgt atgtagcttt agctcagcgc aaagaagagc gccaggctca cctcactaac cagtatatgc agagaatggc aagtgtacga gctgttccca accctgtaat caacccctac cagccagcac ctccttcagg ttacttcatg gcagctatcc cacagactca gaaccgtgct gcatactatc ctcctagcca aattgctcaa ctaagaccaa gtcctcgctg gactgctcag ggtgccagac ctcatccatt ccaaaatatg cccggtgcta tccgcccagc tgctcctaga ccaccattta gtactatgag accagcttct tcacaggttc cacgagtcat gtcaacacag cgtgttgcta acacatcaac acagacaatg ggtccacgtc ctgcagctgc agccgctgca gctactcctg ctgtccgcac cgttccacag tataaatatg ctgcaggagt tcgcaatcct cagcaacatc ttaatgcaca gccacaagtt acaatgcaac agcctgctgt tcatgtacaa ggtcaggaac ctttgactgc ttccatgttg gcatctgccc ctcctcaaga gcaaaagcaa atgttgggtg aacggctgtt tcctcttatt caagccatgc accctactct tgctggtaaa atcactggca tgttgttgga gattgataat tcagaacttc ttcatatgct cgagtctcca gagtcactcc gttctaaggt tgatgaagct gtagctgtac tacaagccca ccaagctaaa gaggctgccc agaaagcagt taacagtgcc accggtgttc caactgttta a. It is sometimes possible for the material contained within the vial of "PABPC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.