Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

P2RX7 cdna clone

P2RX7 cDNA Clone

Gene Names
P2RX7; P2X7
Synonyms
P2RX7; P2RX7 cDNA Clone; P2RX7 cdna clone
Ordering
For Research Use Only!
Sequence
atgccggcctgctgcagctgcagtgatgttttccagtatgagacgaacaaagtcactcggatccagagcatgaattatggcaccattaagtggttcttccacgtgatcatcttttcctacgtttgctttgctctggtgagtgacaagctgtaccagcggaaagagcctgtcatcagttctgtgcacaccaaggtgaaggggatagcagaggtgaaagaggagatcgtggagaatggagtgaagaagttggtgcacagtgtctttgacaccgcagactacaccttccctttgcaggggaactctttcttcgtgatgacaaactttctcaaaacagaaggccaagagcagcggttgtgtcccgagtatcccacccgcaggacgctctgttcctctgaccgaggttgtaaaaagggatggatggacccgcagagcaaaggaattcagaccggaaggtgtgtagtgcatgaagggaaccagaagacctgtgaagtctctgcctggtgccccatcgaggcagtggaagaggccccccggcctgctctcttgaacagtgccgaaaacttcactgtgctcatcaagaacaatatcgacttccccggccacaactacaccacgagaaacatcctgccaggtttaaacatcacttgtaccttccacaagactcagaatccacagtgtcccattttccgactaggagacatcttccgagaaacaggcgataatttttcagatgtggcaattcagggcggaataatgggcattgagatctactgggactgcaacctagaccgttggttccatcactgccatcccaaatacagtttccgtcgccttgacgacaagaccaccaacgtgtccttgtaccctggctacaacttcagatacgccaagtactacaaggaaaacaatgttgagaaacggactctgataaaagtcttcgggatccgttttgacatcctggtttttggcaccggaggaaaatttgacattatccagctggttgtgtacatcggctcaaccctctcctacttcggtctggccgctgtgttcatcgacttcctcatcgacacttactccagtaactgctgtcgctcccatatttatccctggtgcaagtgctgtcagccctgtgtggtcaacgaatactactacaggaagaagtgcgagtccattgtggagccaaagccgacattaaagtatgtgtcctttgtggatgaatcccacattaggatggtgaaccagcagctactagggagaagtctgcaagatgtcaagggccaagaagtcccaagacctgcgatggacttcacagatttgtccaggctgcccctggccctccatgacacacccccgattcctggacaaccagaggagatacagctgcttagaaaggaggcgactcctagatccagggatagccccgtctggtgccagtgtggaagctgcctcccatctcaactccctgagagccacaggtgcctggaggagctgtgctgccggaaaaagccgggggcctgcatcaccacctcagagctgttcaggaagctggtcctgtccagacacgtcctgcagttcctcctgctctaccaggagcccttgctggcgctggatgtggattccaccaacagccggctgcggcactgtgcctacaggtgctacgccacctggcgcttcggctcccaggacatggctgactttgccatcctgcccagctgctgccgctggaggatccggaaagagtttccgaagagtgaagggcagtacagtggcttcaagagtccttactga
Sequence Length
1788
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
58,239 Da
NCBI Official Full Name
Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 7, mRNA
NCBI Official Synonym Full Names
purinergic receptor P2X 7
NCBI Official Symbol
P2RX7
NCBI Official Synonym Symbols
P2X7
NCBI Protein Information
P2X purinoceptor 7
UniProt Protein Name
P2X purinoceptor 7
Protein Family
UniProt Gene Name
P2RX7
UniProt Synonym Gene Names
P2X7
UniProt Entry Name
P2RX7_HUMAN

NCBI Description

The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel and is responsible for ATP-dependent lysis of macrophages through the formation of membrane pores permeable to large molecules. Activation of this nuclear receptor by ATP in the cytoplasm may be a mechanism by which cellular activity can be coupled to changes in gene expression. Multiple alternatively spliced variants have been identified, most of which fit nonsense-mediated decay (NMD) criteria. [provided by RefSeq, Jul 2010]

Uniprot Description

P2X7: a receptor for ATP that acts as a ligand-gated ion channel. Responsible for ATP-dependent lysis by macrophages through the formation of membrane pores permeable to large molecules. Activation of this nuclear receptor by ATP in the cytoplasm may be a mechanism by which cellular activity can be coupled to changes in gene expression. Alternatively spliced variants encoding different isoforms have been identified. Could function in both fast synaptic transmission and the ATP-mediated lysis of antigen-presenting cells. Phosphorylation results in its inactivation.

Protein type: Receptor, misc.; Channel, ligand-gated; Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 12q24

Cellular Component: cytoplasm; integral to nuclear inner membrane; integral to plasma membrane; membrane; plasma membrane

Molecular Function: ATP binding; ATP-gated cation channel activity; lipopolysaccharide binding; protein binding; purinergic nucleotide receptor activity; receptor binding

Biological Process: bleb formation; blood coagulation; cell surface receptor linked signal transduction; membrane depolarization; negative regulation of bone resorption; negative regulation of cell volume; negative regulation of MAPKKK cascade; phospholipid scrambling; pore complex biogenesis; positive regulation of bone mineralization; positive regulation of cytolysis; positive regulation of cytoskeleton organization and biogenesis; positive regulation of glycolysis; positive regulation of interleukin-1 beta secretion; regulation of sodium ion transport; response to ATP; sensory perception of pain

Disease: Leukemia, Chronic Lymphocytic

Research Articles on P2RX7

Similar Products

Product Notes

The P2RX7 p2rx7 (Catalog #AAA1278499) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccggcct gctgcagctg cagtgatgtt ttccagtatg agacgaacaa agtcactcgg atccagagca tgaattatgg caccattaag tggttcttcc acgtgatcat cttttcctac gtttgctttg ctctggtgag tgacaagctg taccagcgga aagagcctgt catcagttct gtgcacacca aggtgaaggg gatagcagag gtgaaagagg agatcgtgga gaatggagtg aagaagttgg tgcacagtgt ctttgacacc gcagactaca ccttcccttt gcaggggaac tctttcttcg tgatgacaaa ctttctcaaa acagaaggcc aagagcagcg gttgtgtccc gagtatccca cccgcaggac gctctgttcc tctgaccgag gttgtaaaaa gggatggatg gacccgcaga gcaaaggaat tcagaccgga aggtgtgtag tgcatgaagg gaaccagaag acctgtgaag tctctgcctg gtgccccatc gaggcagtgg aagaggcccc ccggcctgct ctcttgaaca gtgccgaaaa cttcactgtg ctcatcaaga acaatatcga cttccccggc cacaactaca ccacgagaaa catcctgcca ggtttaaaca tcacttgtac cttccacaag actcagaatc cacagtgtcc cattttccga ctaggagaca tcttccgaga aacaggcgat aatttttcag atgtggcaat tcagggcgga ataatgggca ttgagatcta ctgggactgc aacctagacc gttggttcca tcactgccat cccaaataca gtttccgtcg ccttgacgac aagaccacca acgtgtcctt gtaccctggc tacaacttca gatacgccaa gtactacaag gaaaacaatg ttgagaaacg gactctgata aaagtcttcg ggatccgttt tgacatcctg gtttttggca ccggaggaaa atttgacatt atccagctgg ttgtgtacat cggctcaacc ctctcctact tcggtctggc cgctgtgttc atcgacttcc tcatcgacac ttactccagt aactgctgtc gctcccatat ttatccctgg tgcaagtgct gtcagccctg tgtggtcaac gaatactact acaggaagaa gtgcgagtcc attgtggagc caaagccgac attaaagtat gtgtcctttg tggatgaatc ccacattagg atggtgaacc agcagctact agggagaagt ctgcaagatg tcaagggcca agaagtccca agacctgcga tggacttcac agatttgtcc aggctgcccc tggccctcca tgacacaccc ccgattcctg gacaaccaga ggagatacag ctgcttagaa aggaggcgac tcctagatcc agggatagcc ccgtctggtg ccagtgtgga agctgcctcc catctcaact ccctgagagc cacaggtgcc tggaggagct gtgctgccgg aaaaagccgg gggcctgcat caccacctca gagctgttca ggaagctggt cctgtccaga cacgtcctgc agttcctcct gctctaccag gagcccttgc tggcgctgga tgtggattcc accaacagcc ggctgcggca ctgtgcctac aggtgctacg ccacctggcg cttcggctcc caggacatgg ctgactttgc catcctgccc agctgctgcc gctggaggat ccggaaagag tttccgaaga gtgaagggca gtacagtggc ttcaagagtc cttactga. It is sometimes possible for the material contained within the vial of "P2RX7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.