Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

OPRL1 cdna clone

OPRL1 cDNA Clone

Gene Names
OPRL1; NOP; OOR; NOPr; ORL1; KOR-3; NOCIR
Synonyms
OPRL1; OPRL1 cDNA Clone; OPRL1 cdna clone
Ordering
For Research Use Only!
Sequence
atggagcccctcttccccgcgccgttctgggaggttatctacggcagccaccttcagggcaacctgtccctcctgagccccaaccacagtctgctgcccccgcatctgctgctcaatgccagccacggcgccttcctgcccctcgggctcaaggtcaccatcgtggggctctacctggccgtgtgtgtcggagggctcctggggaactgccttgtcatgtacgtcatcctcaggcacaccaaaatgaagacagccaccaatatttacatctttaacctggccctggccgacactctggtcctgctgacgctgcccttccagggcacggacatcctcctgggcttctggccgtttgggaatgcgctgtgcaagacagtcattgccattgactactacaacatgttcaccagcaccttcaccctaactgccatgagtgtggatcgctatgtagccatctgccaccccatccgtgccctcgacgtccgcacgtccagcaaagcccaggctgtcaatgtggccatctgggccctggcctctgttgtcggtgttcccgttgccatcatgggctcggcacaggtcgaggatgaagagatcgagtgcctggtggagatccctacccctcaggattactggggcccggtgtttgccatctgcatcttcctcttctccttcatcgtccccgtgctcgtcatctctgtctgctacagcctcatgatccggcggctccgtggagtccgcctgctctcgggctcccgagagaaggaccggaacctgcggcgcatcactcggctggtgctggtggtagtggctgtgttcgtgggctgctggacgcctgtccaggtcttcgtgctggcccaagggctgggggttcagccgagcagcgagactgccgtggccattctgcgcttctgcacggccctgggctacgtcaacagctgcctcaaccccatcctctacgccttcctggatgagaacttcaaggcctgcttccgcaagttctgctgtgcatctgccctgcgccgggacgtgcaggtgtctgaccgcgtgcgcagcattgccaaggacgtggccctggcctgcaagacctctgagacggtaccgcggcccgcatga
Sequence Length
1113
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,048 Da
NCBI Official Full Name
Homo sapiens opiate receptor-like 1, mRNA
NCBI Official Synonym Full Names
opioid related nociceptin receptor 1
NCBI Official Symbol
OPRL1
NCBI Official Synonym Symbols
NOP; OOR; NOPr; ORL1; KOR-3; NOCIR
NCBI Protein Information
nociceptin receptor
UniProt Protein Name
Nociceptin receptor
Protein Family
UniProt Gene Name
OPRL1
UniProt Synonym Gene Names
OOR; ORL1; KOR-3
UniProt Entry Name
OPRX_HUMAN

NCBI Description

The protein encoded by this gene is a member of the 7 transmembrane-spanning G protein-coupled receptor family, and functions as a receptor for the endogenous, opioid-related neuropeptide, nociceptin/orphanin FQ. This receptor-ligand system modulates a variety of biological functions and neurobehavior, including stress responses and anxiety behavior, learning and memory, locomotor activity, and inflammatory and immune responses. A promoter region between this gene and the 5'-adjacent RGS19 (regulator of G-protein signaling 19) gene on the opposite strand functions bi-directionally as a core-promoter for both genes, suggesting co-operative transcriptional regulation of these two functionally related genes. Alternatively spliced transcript variants have been described for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Jan 2016]

Uniprot Description

KOR-3: Receptor for the neuropeptide nociceptin/orphanin FQ. Has a potential role in modulating a number of brain functions, including instinctive behaviors and emotions. The activity of this receptor is mediated by G proteins which inhibits adenylyl cyclase. Belongs to the G-protein coupled receptor 1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Membrane protein, integral; Receptor, GPCR; GPCR, family 1

Chromosomal Location of Human Ortholog: 20q13.33

Cellular Component: integral to plasma membrane; neuron projection; plasma membrane

Molecular Function: G-protein coupled receptor activity; neuropeptide binding; nociceptin/orphanin-FQ receptor activity; protein binding

Biological Process: elevation of cytosolic calcium ion concentration; G-protein signaling, adenylate cyclase inhibiting pathway; neuropeptide signaling pathway; sensory perception; sensory perception of pain; synaptic transmission

Research Articles on OPRL1

Similar Products

Product Notes

The OPRL1 oprl1 (Catalog #AAA1272285) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcccc tcttccccgc gccgttctgg gaggttatct acggcagcca ccttcagggc aacctgtccc tcctgagccc caaccacagt ctgctgcccc cgcatctgct gctcaatgcc agccacggcg ccttcctgcc cctcgggctc aaggtcacca tcgtggggct ctacctggcc gtgtgtgtcg gagggctcct ggggaactgc cttgtcatgt acgtcatcct caggcacacc aaaatgaaga cagccaccaa tatttacatc tttaacctgg ccctggccga cactctggtc ctgctgacgc tgcccttcca gggcacggac atcctcctgg gcttctggcc gtttgggaat gcgctgtgca agacagtcat tgccattgac tactacaaca tgttcaccag caccttcacc ctaactgcca tgagtgtgga tcgctatgta gccatctgcc accccatccg tgccctcgac gtccgcacgt ccagcaaagc ccaggctgtc aatgtggcca tctgggccct ggcctctgtt gtcggtgttc ccgttgccat catgggctcg gcacaggtcg aggatgaaga gatcgagtgc ctggtggaga tccctacccc tcaggattac tggggcccgg tgtttgccat ctgcatcttc ctcttctcct tcatcgtccc cgtgctcgtc atctctgtct gctacagcct catgatccgg cggctccgtg gagtccgcct gctctcgggc tcccgagaga aggaccggaa cctgcggcgc atcactcggc tggtgctggt ggtagtggct gtgttcgtgg gctgctggac gcctgtccag gtcttcgtgc tggcccaagg gctgggggtt cagccgagca gcgagactgc cgtggccatt ctgcgcttct gcacggccct gggctacgtc aacagctgcc tcaaccccat cctctacgcc ttcctggatg agaacttcaa ggcctgcttc cgcaagttct gctgtgcatc tgccctgcgc cgggacgtgc aggtgtctga ccgcgtgcgc agcattgcca aggacgtggc cctggcctgc aagacctctg agacggtacc gcggcccgca tga. It is sometimes possible for the material contained within the vial of "OPRL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.