Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NUDT9 cdna clone

NUDT9 cDNA Clone

Gene Names
NUDT9; NUDT10
Synonyms
NUDT9; NUDT9 cDNA Clone; NUDT9 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgggacgcctcctgggaaaggctttagccgcggtgtctctctctctggccttggcctctgtgactatcaggtcctcgcgctgccgcggcatccaggcgttcagaaactcgttttcatcttcttggtttcatcttaataccaacgtcatgtctggttctaatggttccaaagaaaattctcacaataaggctcggacgtctccttacccaggttcaaaagttgaacgaagccaggttcctaatgagaaagtgggctggcttgttgagtggcaagactataagcctgtggaatacactgcagtctctgtcttggctggacccaggtgggcagatcctcagatcagtgaaagtaatttttctcccaagtttaacgaaaaggatgggcatgttgagagaaagagcaagaatggcctgtatgagattgaaaatggaagaccgagaaatcctgcaggacggactggactggtgggccgggggcttttggggcgatggggcccaaatcacgctgcagatcccattataaccagatggaaaagggatagcagtggaaataaaatcatgcatcctgtttctgggaagcatatcttacaatttgttgcaataaaaaggaaagactgtggagaatgggcaatcccaggggggatggtggatccaggagagaagattagtgccacactgaaaagagaatttggtgaggaagctctcaactccttacagaaaaccagtgctgagaagagagaaatagaggaaaagttgcacaaactcttcagccaagaccacctagtgatatataagggatatgttgatgatcctcgaaacactgataatgcatggatggagacagaagctgtgaactaccatgacgaaacaggtgagataatggataatcttatgctagaagctggagatgatgctggaaaagtgaaatgggtggacatcaatgataaactgaagctttatgccagtcactctcaattcatcaaacttgtggctgagaaacgagatgcacactggagcgaggactctgaagctgactgccatgcgttgtag
Sequence Length
1053
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,776 Da
NCBI Official Full Name
Homo sapiens nudix (nucleoside diphosphate linked moiety X)-type motif 9, mRNA
NCBI Official Synonym Full Names
nudix hydrolase 9
NCBI Official Symbol
NUDT9
NCBI Official Synonym Symbols
NUDT10
NCBI Protein Information
ADP-ribose pyrophosphatase, mitochondrial
UniProt Protein Name
ADP-ribose pyrophosphatase, mitochondrial
Protein Family
UniProt Gene Name
NUDT9
UniProt Synonym Gene Names
NUDT10; ADPR-PPase; Nudix motif 9
UniProt Entry Name
NUDT9_HUMAN

NCBI Description

The protein encoded by this gene belongs to the Nudix hydrolase family. Nudix boxes are found in a family of diverse enzymes that catalyze the hydrolysis of nucleoside diphosphate derivatives. This enzyme is an ADP-ribose pyrophosphatase that catalyzes the hydrolysis of ADP-ribose to AMP and ribose-5-P. It requires divalent metal ions and an intact Nudix motif for enzymatic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Uniprot Description

NUDT9: Hydrolyzes ADP-ribose (ADPR) to AMP and ribose 5'- phosphate. Belongs to the Nudix hydrolase family. NudF subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.6.1.13; Nucleotide Metabolism - purine; Hydrolase; Mitochondrial

Chromosomal Location of Human Ortholog: 4q22.1

Cellular Component: mitochondrial matrix

Molecular Function: ADP-ribose diphosphatase activity

Research Articles on NUDT9

Similar Products

Product Notes

The NUDT9 nudt9 (Catalog #AAA1269039) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgggac gcctcctggg aaaggcttta gccgcggtgt ctctctctct ggccttggcc tctgtgacta tcaggtcctc gcgctgccgc ggcatccagg cgttcagaaa ctcgttttca tcttcttggt ttcatcttaa taccaacgtc atgtctggtt ctaatggttc caaagaaaat tctcacaata aggctcggac gtctccttac ccaggttcaa aagttgaacg aagccaggtt cctaatgaga aagtgggctg gcttgttgag tggcaagact ataagcctgt ggaatacact gcagtctctg tcttggctgg acccaggtgg gcagatcctc agatcagtga aagtaatttt tctcccaagt ttaacgaaaa ggatgggcat gttgagagaa agagcaagaa tggcctgtat gagattgaaa atggaagacc gagaaatcct gcaggacgga ctggactggt gggccggggg cttttggggc gatggggccc aaatcacgct gcagatccca ttataaccag atggaaaagg gatagcagtg gaaataaaat catgcatcct gtttctggga agcatatctt acaatttgtt gcaataaaaa ggaaagactg tggagaatgg gcaatcccag gggggatggt ggatccagga gagaagatta gtgccacact gaaaagagaa tttggtgagg aagctctcaa ctccttacag aaaaccagtg ctgagaagag agaaatagag gaaaagttgc acaaactctt cagccaagac cacctagtga tatataaggg atatgttgat gatcctcgaa acactgataa tgcatggatg gagacagaag ctgtgaacta ccatgacgaa acaggtgaga taatggataa tcttatgcta gaagctggag atgatgctgg aaaagtgaaa tgggtggaca tcaatgataa actgaagctt tatgccagtc actctcaatt catcaaactt gtggctgaga aacgagatgc acactggagc gaggactctg aagctgactg ccatgcgttg tag. It is sometimes possible for the material contained within the vial of "NUDT9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.