NUDT6 cdna clone
NUDT6 cDNA Clone
Gene Names
NUDT6; GFG1; GFG-1; ASFGF2; FGF-AS; FGF2AS
Synonyms
NUDT6; NUDT6 cDNA Clone; NUDT6 cdna clone
Sequence
atgcggcagccgctgagctggggccgctggcgcgcgatgcttgcccgaacctacggccccgggccttcggcgggttaccgctgggcctcgggcgcacagggttacgtgcggaatccgccagttggagcgtgcgatctgcagggcgagctggacagattcgggggcatctcggtgcgcctggcgcggctcgatgcgctggaccgcctggacgctgccgccttccagaagggcttgcaggctgcagtacagcaatggcgatcagaaggtagaacagctgtatggctgcacattcccatcctccaaagccgatttattgcccctgctgcttccctgggcttctgctttcaccacgcagaatcggattcatcaacgttgactctgtggctgagagaagggcccagcagattaccaggatatgcttcacatcaagtaggagttgcaggagctgtatttgatgaaagtactagaaaaatactggttgtacaagatcgaaataaattgaaaaatatgtggaagtttccaggaggcctgtcagagcctgaagaagatattggagacacagcggttcgagaagtttttgaagagactggtataaaatcagaattcaggtccgtcctgagtattcggcaacagcacacaaatcctggagcttttgggaagtcagatatgtatatcatctgccgcctaaagccatattcattcaccataaatttttgccaggaagaatgcttaagatgtgagtggatggatctcaatgacctggcgaagactgaaaatacaactcccatcaccagcagagttgctaggctgctgctgtatgggtacagagaagggtttgacaaaattgacctgactgtggaagaacttccagcagtttacacaggactgttttataaactctatcataaggaactgccagagaattataaaactatgaaaggaattgattaa
Sequence Length
951
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
17,082 Da
NCBI Official Full Name
Homo sapiens nudix (nucleoside diphosphate linked moiety X)-type motif 6, mRNA
NCBI Official Synonym Full Names
nudix hydrolase 6
NCBI Official Symbol
NUDT6
NCBI Official Synonym Symbols
GFG1; GFG-1; ASFGF2; FGF-AS; FGF2AS
NCBI Protein Information
nucleoside diphosphate-linked moiety X motif 6
UniProt Protein Name
Nucleoside diphosphate-linked moiety X motif 6
Protein Family
UniProt Gene Name
NUDT6
UniProt Synonym Gene Names
FGF2AS; Nudix motif 6
UniProt Entry Name
NUDT6_HUMAN
NCBI Description
This gene overlaps and lies on the opposite strand from FGF2 gene, and is thought to be the FGF2 antisense gene. The two genes are independently transcribed, and their expression shows an inverse relationship, suggesting that this antisense transcript may regulate FGF2 expression. This gene has also been shown to have hormone-regulatory and antiproliferative actions in the pituitary that are independent of FGF2 expression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Uniprot Description
NUDT6: May contribute to the regulation of cell proliferation. Belongs to the Nudix hydrolase family. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 4q26
Molecular Function: growth factor activity
Research Articles on NUDT6
Similar Products
Product Notes
The NUDT6 nudt6 (Catalog #AAA1275498) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcggcagc cgctgagctg gggccgctgg cgcgcgatgc ttgcccgaac ctacggcccc gggccttcgg cgggttaccg ctgggcctcg ggcgcacagg gttacgtgcg gaatccgcca gttggagcgt gcgatctgca gggcgagctg gacagattcg ggggcatctc ggtgcgcctg gcgcggctcg atgcgctgga ccgcctggac gctgccgcct tccagaaggg cttgcaggct gcagtacagc aatggcgatc agaaggtaga acagctgtat ggctgcacat tcccatcctc caaagccgat ttattgcccc tgctgcttcc ctgggcttct gctttcacca cgcagaatcg gattcatcaa cgttgactct gtggctgaga gaagggccca gcagattacc aggatatgct tcacatcaag taggagttgc aggagctgta tttgatgaaa gtactagaaa aatactggtt gtacaagatc gaaataaatt gaaaaatatg tggaagtttc caggaggcct gtcagagcct gaagaagata ttggagacac agcggttcga gaagtttttg aagagactgg tataaaatca gaattcaggt ccgtcctgag tattcggcaa cagcacacaa atcctggagc ttttgggaag tcagatatgt atatcatctg ccgcctaaag ccatattcat tcaccataaa tttttgccag gaagaatgct taagatgtga gtggatggat ctcaatgacc tggcgaagac tgaaaataca actcccatca ccagcagagt tgctaggctg ctgctgtatg ggtacagaga agggtttgac aaaattgacc tgactgtgga agaacttcca gcagtttaca caggactgtt ttataaactc tatcataagg aactgccaga gaattataaa actatgaaag gaattgatta a. It is sometimes possible for the material contained within the vial of "NUDT6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
