Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NUDT14 cdna clone

NUDT14 cDNA Clone

Gene Names
NUDT14; UGPP; UGPPase
Synonyms
NUDT14; NUDT14 cDNA Clone; NUDT14 cdna clone
Ordering
For Research Use Only!
Sequence
atggagcgcatcgagggggcgtccgtgggccgctgcgccgcctcaccctacctgcggccgctcacgctgcattaccgccagaatggtgcccagaagtcctgggacttcatgaagacgcatgacagcgtgaccgttctcttattcaactcttctcggaggagcctggtgttggtgaagcagttccggccagctgtgtatgcgggtgaggtggagcgccgcttcccagggtccctagcagctgtagaccaggacgggcctcgggagctacagccagccctgcccggctcagcgggggtgacagttgagctgtgtgccggcctcgtggaccagcctgggctctcgctggaggaagtggcttgcaaggaggcttgggaggagtgtggctaccacttggccccctctgatctgcgccgggtcgccacatactggtctggagtgggactgactggctccagacagaccatgttctacacagaggtgacagatgcccagcgtagcggtccaggtgggggcctggtggaggagggtgagctcattgaggtggtgcacctgcccctggaaggcgcccaggcctttgcagacgacccggacatccccaagaccctcggcgtcatctttggtgtctcatggttcctcagccaggtggcccccaacctggatctccagtga
Sequence Length
669
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,118 Da
NCBI Official Full Name
Homo sapiens nudix (nucleoside diphosphate linked moiety X)-type motif 14, mRNA
NCBI Official Synonym Full Names
nudix hydrolase 14
NCBI Official Symbol
NUDT14
NCBI Official Synonym Symbols
UGPP; UGPPase
NCBI Protein Information
uridine diphosphate glucose pyrophosphatase
UniProt Protein Name
Uridine diphosphate glucose pyrophosphatase
Protein Family
UniProt Gene Name
NUDT14
UniProt Synonym Gene Names
UGPP; UDPG pyrophosphatase; UGPPase; Nudix motif 14
UniProt Entry Name
NUD14_HUMAN

NCBI Description

The protein encoded by this gene is a member of the Nudix hydrolase family. Nudix hydrolases eliminate potentially toxic nucleotide metabolites from the cell and regulate the concentrations and availability of many different nucleotide substrates, cofactors, and signaling molecules. This enzyme contains a Nudix hydrolase domain and is a UDPG pyrophosphatase that hydrolyzes UDPG to produce glucose 1-phosphate and UMP. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]

Uniprot Description

NUDT14: Hydrolyzes UDP-glucose to glucose 1-phosphate and UMP and ADP-ribose to ribose 5-phosphate and AMP. The physiological substrate is probably UDP-glucose. Poor activity on other substrates such as ADP-glucose, CDP-glucose, GDP-glucose and GDP- mannose. Belongs to the Nudix hydrolase family.

Protein type: EC 3.6.1.45; Hydrolase

Chromosomal Location of Human Ortholog: 14q32.33

Cellular Component: cytosol

Molecular Function: protein binding; UDP-sugar diphosphatase activity

Biological Process: protein amino acid N-linked glycosylation via asparagine

Similar Products

Product Notes

The NUDT14 nudt14 (Catalog #AAA1277378) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcgca tcgagggggc gtccgtgggc cgctgcgccg cctcacccta cctgcggccg ctcacgctgc attaccgcca gaatggtgcc cagaagtcct gggacttcat gaagacgcat gacagcgtga ccgttctctt attcaactct tctcggagga gcctggtgtt ggtgaagcag ttccggccag ctgtgtatgc gggtgaggtg gagcgccgct tcccagggtc cctagcagct gtagaccagg acgggcctcg ggagctacag ccagccctgc ccggctcagc gggggtgaca gttgagctgt gtgccggcct cgtggaccag cctgggctct cgctggagga agtggcttgc aaggaggctt gggaggagtg tggctaccac ttggccccct ctgatctgcg ccgggtcgcc acatactggt ctggagtggg actgactggc tccagacaga ccatgttcta cacagaggtg acagatgccc agcgtagcgg tccaggtggg ggcctggtgg aggagggtga gctcattgag gtggtgcacc tgcccctgga aggcgcccag gcctttgcag acgacccgga catccccaag accctcggcg tcatctttgg tgtctcatgg ttcctcagcc aggtggcccc caacctggat ctccagtga. It is sometimes possible for the material contained within the vial of "NUDT14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.