NUDT13 cdna clone
NUDT13 cDNA Clone
Synonyms
NUDT13; NUDT13 cDNA Clone; NUDT13 cdna clone
Sequence
atgtccctgtattgtggaatagcttgcaggagaaaatttttttggtgctataggctgctgtcaacctatgttactaagacacggtatttatttgaactgaaggaagatgatgatgcatgtaaaaaagcccagcaaacaggagcgttttacctctttcatagtctggctcctctgcttcagacttcagcacatcaatacctggccccccggcacagcctgttagagttggaaaggctcctgggtaaatttggacaggatgcacaaagaatagaagattctgtgctgattggatgctctgagcagcaggaagcatggtttgctctggatctaggtctggatagctccttttccataagtgcctccttacacaaacctgaaatggagacagagctcaaggggtctttcattgagctgagaaaggcactctttcaactcaatgcaagggatgcctccttgctgtccacggctcaagctcttctccgctggcatgatgctcatcagttctgcagcagaagtgggcagcccaccaagaagaacgtggctggcagcaagcgtgtgtgcccttccaataatataatctattatccacagatccaggtgaacttgagagaattagagacagctgcctggttcagtcatgatgaggtagccacagccctgaagagaaagggcccctatactcagcaacagaatgggactttcccattctggctgccccctaagttagccatctcccaccaactgattaaggagtgggtggaaaaacagacctgttcttccctgcctgcttag
Sequence Length
792
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
26,965 Da
NCBI Official Full Name
Homo sapiens nudix (nucleoside diphosphate linked moiety X)-type motif 13, mRNA
NCBI Official Synonym Full Names
nudix hydrolase 13
NCBI Official Symbol
NUDT13
NCBI Protein Information
nucleoside diphosphate-linked moiety X motif 13
UniProt Protein Name
Nucleoside diphosphate-linked moiety X motif 13
Protein Family
UniProt Gene Name
NUDT13
UniProt Synonym Gene Names
Nudix motif 13
UniProt Entry Name
NUD13_HUMAN
Uniprot Description
NUDT13: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 3.-.-.-; Hydrolase
Chromosomal Location of Human Ortholog: 10q22.1
Cellular Component: mitochondrial matrix
Molecular Function: pyrophosphatase activity
Biological Process: nucleobase, nucleoside and nucleotide interconversion
Research Articles on NUDT13
Similar Products
Product Notes
The NUDT13 nudt13 (Catalog #AAA1273102) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccctgt attgtggaat agcttgcagg agaaaatttt tttggtgcta taggctgctg tcaacctatg ttactaagac acggtattta tttgaactga aggaagatga tgatgcatgt aaaaaagccc agcaaacagg agcgttttac ctctttcata gtctggctcc tctgcttcag acttcagcac atcaatacct ggccccccgg cacagcctgt tagagttgga aaggctcctg ggtaaatttg gacaggatgc acaaagaata gaagattctg tgctgattgg atgctctgag cagcaggaag catggtttgc tctggatcta ggtctggata gctccttttc cataagtgcc tccttacaca aacctgaaat ggagacagag ctcaaggggt ctttcattga gctgagaaag gcactctttc aactcaatgc aagggatgcc tccttgctgt ccacggctca agctcttctc cgctggcatg atgctcatca gttctgcagc agaagtgggc agcccaccaa gaagaacgtg gctggcagca agcgtgtgtg cccttccaat aatataatct attatccaca gatccaggtg aacttgagag aattagagac agctgcctgg ttcagtcatg atgaggtagc cacagccctg aagagaaagg gcccctatac tcagcaacag aatgggactt tcccattctg gctgccccct aagttagcca tctcccacca actgattaag gagtgggtgg aaaaacagac ctgttcttcc ctgcctgctt ag. It is sometimes possible for the material contained within the vial of "NUDT13, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
