NSUN7 cdna clone
NSUN7 cDNA Clone
Synonyms
NSUN7; NSUN7 cDNA Clone; NSUN7 cdna clone
Sequence
atgctgaattccacgggcgaactggagttttcgaacgaagaagatcccgagatcatctcccaactcacttccctgcctctgtccggtgggaaaagctcagctggtgtgcccgaaaaaacgggctatccggactccgtttatgtcatggcagccaacatttttcagggtattcgaatcgaaaagtcggcacagaaagtcttaatcaagtatgggaatgaacccctgcggtccttgtccgagtctgaggatcagtcctttcagcgtttgtcttatgagctggctttcagtgccctgaaatatcaagatattttggaaactatattgatagacagctgtatcttcccaagtaccacaataccagatcatttgagcagtcttattattgtgatgctatatgatttccaagatagaaaatttcaaactcgtgtcctttctgataatgaagagcccatatcagaagttcaagaagtagagaaccttcttaacagttttaagataaaattggctgcagcattggcaagatgtcgaatcaagcatgatgccctttcaatttaccacatccttccagaaacagttaggaaacaggaactaagggcctccactttaccactttatgcttggataaatacttgtaaaatcagccctgaagaagtttataataatttgaagagaagaggctataataaagtcaaatctgtattgcatattgatgataaagtctttgctgtggatcaacattgctatgatgtcttaatttttccatctcatcttaaaaatgatcttataaatatagatcttttcaaagattacaaacttatatttcaggacaaatctcgaagtcttgctgtccattctgtaaaggctttattaaatatggatgatgatgtcttaatggtcaatacaggttcatggtacacagttgcccacatgtcaattttaacaaataataatacctcaaaagtatttgtgtgtggagtacaatcacaagctaaggatcctgacttgaagacccttttcacaaaaataggatgtaaaaatattgaaatacttcatgagaaatttattaacattgaatcaaaggatcacaggttacagaaagttaaagtgattttgctgctacctcgttgttcaggactgggtgttagtaatccagtagaatttattttaaatgaacatgaagatacagaattccttaaagatcactctcaaggaggcatctcagtggacaaacttcacgttcttgctcaacagcagtatgaacagctaacacatgcaatgaaatttactaaagctcaagcagttgtttactgcacatgttcagtttttccagaagaaaatgaagctgttgttaagaaagcactggaatttcaagaccttgggaataaaggacaaccttacagcgggacccttctgagacagtgtctgtga
Sequence Length
1428
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
31,642 Da
NCBI Official Full Name
Homo sapiens NOL1/NOP2/Sun domain family, member 7, mRNA
NCBI Official Synonym Full Names
NOP2/Sun RNA methyltransferase family member 7
NCBI Official Symbol
NSUN7
NCBI Protein Information
putative methyltransferase NSUN7
UniProt Protein Name
Putative methyltransferase NSUN7
Protein Family
UniProt Gene Name
NSUN7
UniProt Entry Name
NSUN7_HUMAN
Uniprot Description
NSUN7: May have S-adenosyl-L-methionine-dependent methyl- transferase activity. Belongs to the methyltransferase superfamily. RsmB/NOP family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 2.1.1.-; Methyltransferase
Chromosomal Location of Human Ortholog: 4p14
Research Articles on NSUN7
Similar Products
Product Notes
The NSUN7 nsun7 (Catalog #AAA1272225) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgaatt ccacgggcga actggagttt tcgaacgaag aagatcccga gatcatctcc caactcactt ccctgcctct gtccggtggg aaaagctcag ctggtgtgcc cgaaaaaacg ggctatccgg actccgttta tgtcatggca gccaacattt ttcagggtat tcgaatcgaa aagtcggcac agaaagtctt aatcaagtat gggaatgaac ccctgcggtc cttgtccgag tctgaggatc agtcctttca gcgtttgtct tatgagctgg ctttcagtgc cctgaaatat caagatattt tggaaactat attgatagac agctgtatct tcccaagtac cacaatacca gatcatttga gcagtcttat tattgtgatg ctatatgatt tccaagatag aaaatttcaa actcgtgtcc tttctgataa tgaagagccc atatcagaag ttcaagaagt agagaacctt cttaacagtt ttaagataaa attggctgca gcattggcaa gatgtcgaat caagcatgat gccctttcaa tttaccacat ccttccagaa acagttagga aacaggaact aagggcctcc actttaccac tttatgcttg gataaatact tgtaaaatca gccctgaaga agtttataat aatttgaaga gaagaggcta taataaagtc aaatctgtat tgcatattga tgataaagtc tttgctgtgg atcaacattg ctatgatgtc ttaatttttc catctcatct taaaaatgat cttataaata tagatctttt caaagattac aaacttatat ttcaggacaa atctcgaagt cttgctgtcc attctgtaaa ggctttatta aatatggatg atgatgtctt aatggtcaat acaggttcat ggtacacagt tgcccacatg tcaattttaa caaataataa tacctcaaaa gtatttgtgt gtggagtaca atcacaagct aaggatcctg acttgaagac ccttttcaca aaaataggat gtaaaaatat tgaaatactt catgagaaat ttattaacat tgaatcaaag gatcacaggt tacagaaagt taaagtgatt ttgctgctac ctcgttgttc aggactgggt gttagtaatc cagtagaatt tattttaaat gaacatgaag atacagaatt ccttaaagat cactctcaag gaggcatctc agtggacaaa cttcacgttc ttgctcaaca gcagtatgaa cagctaacac atgcaatgaa atttactaaa gctcaagcag ttgtttactg cacatgttca gtttttccag aagaaaatga agctgttgtt aagaaagcac tggaatttca agaccttggg aataaaggac aaccttacag cgggaccctt ctgagacagt gtctgtga. It is sometimes possible for the material contained within the vial of "NSUN7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
