Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NR4A2 cdna clone

NR4A2 cDNA Clone

Gene Names
NR4A2; NOT; RNR1; HZF-3; NURR1; TINUR
Synonyms
NR4A2; NR4A2 cDNA Clone; NR4A2 cdna clone
Ordering
For Research Use Only!
Sequence
atgccttgtgttcaggcgcagtatgggtcctcgcctcaaggagccagccccgcttctcagagctacagttaccactcttcgggagaatacagctccgatttcttaactccagagtttgtcaagtttagcatggacctcaccaacactgaaatcactgccaccacttctctccccagcttcagtacctttatggacaactacagcacaggctacgacgtcaagccaccttgcttgtaccaaatgcccctgtccggacagcagtcctccattaaggtagaagacattcagatgcacaactaccagcaacacagccacctgcccccccagtctgaggagatgatgccgcactccgggtcggtttactacaagccctcctcgcccccgacgcccaccaccccgggcttccaggtgcagcacagccccatgtgggacgacccgggatctctccacaacttccaccagaactacgtggccactacgcacatgatcgagcagaggaaaacgccagtctcccgcctctccctcttctcctttaagcaatcgccccctggcaccccggtgtctagttgccagatgcgcttcgacgggcccctgcacgtccccatgaacccggagcccgccggcagccaccacgtggtggacgggcagaccttcgctgtgcccaaccccattcgcaagcccgcgtccatgggcttcccgggcctgcagatcggccacgcgtctcagctgctcgacacgcaggtgccctcaccgccgtcgcggggctccccctccaacgaggggctgtgcgctgtgtgtggggacaacgcggcctgccaacactacggcgtgcgcacctgtgagggctgcaaaggcttctttaagcgcacagtgcaaaaaaatgcaaaatacgtgtgtttagcaaataaaaactgcccagtggacaagcgtcgccggaatcgctgtcagtactgccgatttcagaagtgcctggctgttgggatggtcaaagaagtggttcgcacagacagtttaaaaggccggagaggtcgtttgccctcgaaaccgaagagcccacaggagccctctcccccttcgcccccggtgagtctgatcagtgccctcgtcagggcccatgtcgactccaacccggctatgaccagcctggactattccaggttccaggcgaaccctgactatcaaatgagtggagatgacacccagcatatccagcaattctatgatctcctgactggctccatggagatcatccggggctgggcagagaagatccctggcttcgcagacctgcccaaagccgaccaagacctgctttttgaatcagctttcttagaactgtttgtccttcgattagcatacaggtccaacccagtggagggtaaactcatcttttgcaatggggtggtcttgcacaggttgcaatgcgttcgtggctttggggaatggattgattccattgttgaattctcctccaacttgcagaatatgaacatcgacatttctgccttctcctgcattgctgccctggctatggtcacagagagacacgggctcaaggaacccaagagagtggaagaactgcaaaacaagattgtaaattgtctcaaagaccacgtgactttcaacaatggggggttgaaccgccccaattatttgtccaaactgttggggaagctcccagaacttcgtaccctttgcacacaggggctacagcgcattttctacctgaaattggaagacttggtgccaccgccagcaataattgacaaacttttcctggacactttacctttctaa
Sequence Length
1797
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,809 Da
NCBI Official Full Name
Homo sapiens nuclear receptor subfamily 4, group A, member 2, mRNA
NCBI Official Synonym Full Names
nuclear receptor subfamily 4 group A member 2
NCBI Official Symbol
NR4A2
NCBI Official Synonym Symbols
NOT; RNR1; HZF-3; NURR1; TINUR
NCBI Protein Information
nuclear receptor subfamily 4 group A member 2
UniProt Protein Name
Nuclear receptor subfamily 4 group A member 2
UniProt Gene Name
NR4A2
UniProt Synonym Gene Names
NOT; NURR1; TINUR
UniProt Entry Name
NR4A2_HUMAN

NCBI Description

This gene encodes a member of the steroid-thyroid hormone-retinoid receptor superfamily. The encoded protein may act as a transcription factor. Mutations in this gene have been associated with disorders related to dopaminergic dysfunction, including Parkinson disease, schizophernia, and manic depression. Misregulation of this gene may be associated with rheumatoid arthritis. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

NR4A2: Transcriptional regulator which is important for the differentiation and maintenance of meso-diencephalic dopaminergic (mdDA) neurons during development. It is crucial for expression of a set of genes such as SLC6A3, SLC18A2, TH and DRD2 which are essential for development of mdDA neurons. Belongs to the nuclear hormone receptor family. NR4 subfamily.

Protein type: DNA-binding; Nuclear receptor

Chromosomal Location of Human Ortholog: 2q22-q23

Cellular Component: nucleoplasm; nucleus

Molecular Function: beta-catenin binding; DNA binding; ligand-dependent nuclear receptor activity; protein binding; protein heterodimerization activity; protein homodimerization activity; retinoid X receptor binding

Biological Process: cellular response to extracellular stimulus; fat cell differentiation; negative regulation of transcription from RNA polymerase II promoter; neuron migration; positive regulation of transcription from RNA polymerase II promoter; transcription initiation from RNA polymerase II promoter; transcription, DNA-dependent; Wnt receptor signaling pathway through beta-catenin

Disease: Parkinson Disease, Late-onset

Research Articles on NR4A2

Similar Products

Product Notes

The NR4A2 nr4a2 (Catalog #AAA1276955) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccttgtg ttcaggcgca gtatgggtcc tcgcctcaag gagccagccc cgcttctcag agctacagtt accactcttc gggagaatac agctccgatt tcttaactcc agagtttgtc aagtttagca tggacctcac caacactgaa atcactgcca ccacttctct ccccagcttc agtaccttta tggacaacta cagcacaggc tacgacgtca agccaccttg cttgtaccaa atgcccctgt ccggacagca gtcctccatt aaggtagaag acattcagat gcacaactac cagcaacaca gccacctgcc cccccagtct gaggagatga tgccgcactc cgggtcggtt tactacaagc cctcctcgcc cccgacgccc accaccccgg gcttccaggt gcagcacagc cccatgtggg acgacccggg atctctccac aacttccacc agaactacgt ggccactacg cacatgatcg agcagaggaa aacgccagtc tcccgcctct ccctcttctc ctttaagcaa tcgccccctg gcaccccggt gtctagttgc cagatgcgct tcgacgggcc cctgcacgtc cccatgaacc cggagcccgc cggcagccac cacgtggtgg acgggcagac cttcgctgtg cccaacccca ttcgcaagcc cgcgtccatg ggcttcccgg gcctgcagat cggccacgcg tctcagctgc tcgacacgca ggtgccctca ccgccgtcgc ggggctcccc ctccaacgag gggctgtgcg ctgtgtgtgg ggacaacgcg gcctgccaac actacggcgt gcgcacctgt gagggctgca aaggcttctt taagcgcaca gtgcaaaaaa atgcaaaata cgtgtgttta gcaaataaaa actgcccagt ggacaagcgt cgccggaatc gctgtcagta ctgccgattt cagaagtgcc tggctgttgg gatggtcaaa gaagtggttc gcacagacag tttaaaaggc cggagaggtc gtttgccctc gaaaccgaag agcccacagg agccctctcc cccttcgccc ccggtgagtc tgatcagtgc cctcgtcagg gcccatgtcg actccaaccc ggctatgacc agcctggact attccaggtt ccaggcgaac cctgactatc aaatgagtgg agatgacacc cagcatatcc agcaattcta tgatctcctg actggctcca tggagatcat ccggggctgg gcagagaaga tccctggctt cgcagacctg cccaaagccg accaagacct gctttttgaa tcagctttct tagaactgtt tgtccttcga ttagcataca ggtccaaccc agtggagggt aaactcatct tttgcaatgg ggtggtcttg cacaggttgc aatgcgttcg tggctttggg gaatggattg attccattgt tgaattctcc tccaacttgc agaatatgaa catcgacatt tctgccttct cctgcattgc tgccctggct atggtcacag agagacacgg gctcaaggaa cccaagagag tggaagaact gcaaaacaag attgtaaatt gtctcaaaga ccacgtgact ttcaacaatg gggggttgaa ccgccccaat tatttgtcca aactgttggg gaagctccca gaacttcgta ccctttgcac acaggggcta cagcgcattt tctacctgaa attggaagac ttggtgccac cgccagcaat aattgacaaa cttttcctgg acactttacc tttctaa. It is sometimes possible for the material contained within the vial of "NR4A2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.