Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NR1I3 cdna clone

NR1I3 cDNA Clone

Gene Names
NR1I3; CAR; CAR1; MB67
Synonyms
NR1I3; NR1I3 cDNA Clone; NR1I3 cdna clone
Ordering
For Research Use Only!
Sequence
atggccagtagggaagatgagctgaggaactgtgtggtatgtggggaccaagccacaggctaccactttaatgcgctgacttgtgagggctgcaagggtttcttcaggagaacagtcagcaaaagcattggtcccacctgcccctttgctggaagctgtgaagtcagcaagactcagaggcgccactgcccagcctgcaggttgcagaagtgcttagatgctggcatgaggaaagacatgatactgtcggcagaagccctggcattgcggcgagcaaagcaggcccagcggcgggcacagcaaacacctgtgcaactgagtaaggagcaagaagagctgatccggacactcctgggggcccacacccgccacatgggcaccatgtttgaacagtttgtgcagtttaggcctccagctcatctgttcatccatcaccagcccttgcccaccctggcccctgtgctgcctctggtcacacacttcgcagacatcaacactttcatggtactgcaagtcatcaagtttactaaggacctgcctgtcttccgttccctgcccattgaagaccagatctcccttctcaagggagcagctgtggaaatctgtcacatcgtactcaataccactttctgtctccaaacacaaaacttcctctgcgggcctcttcgctacacaattgaagatggagcccgtgtatctcccacagtggggttccaggtagagtttttggagttgctctttcacttccatggaacactacgaaaactgcagctccaagagcctgagtatgtgctcttggctgccatggccctcttctctcctgaccgacctggagttacccagagagatgagattgatcagctgcaagaggagatggcactgactctgcaaagctacatcaagggccagcagcgaaggccccgggatcggtttctgtatgcgaagttgctaggcctgctggctgagctccggagcattaatgaggcctacgggtaccaaatccagcacatccagggcctgtctgccatgatgccgctgctccaggagatctgcagctga
Sequence Length
1059
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,262 Da
NCBI Official Full Name
Homo sapiens nuclear receptor subfamily 1, group I, member 3, mRNA
NCBI Official Synonym Full Names
nuclear receptor subfamily 1 group I member 3
NCBI Official Symbol
NR1I3
NCBI Official Synonym Symbols
CAR; CAR1; MB67
NCBI Protein Information
nuclear receptor subfamily 1 group I member 3
UniProt Protein Name
Nuclear receptor subfamily 1 group I member 3
UniProt Gene Name
NR1I3
UniProt Synonym Gene Names
CAR; Constitutive active response; CAR
UniProt Entry Name
NR1I3_HUMAN

NCBI Description

This gene encodes a member of the nuclear receptor superfamily, and is a key regulator of xenobiotic and endobiotic metabolism. The protein binds to DNA as a monomer or a heterodimer with the retinoid X receptor and regulates the transcription of target genes involved in drug metabolism and bilirubin clearance, such as cytochrome P450 family members. Unlike most nuclear receptors, this transcriptional regulator is constitutively active in the absence of ligand but is regulated by both agonists and inverse agonists. Ligand binding results in translocation of this protein to the nucleus, where it activates or represses target gene transcription. These ligands include bilirubin, a variety of foreign compounds, steroid hormones, and prescription drugs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

NR1I3: Binds and transactivates the retinoic acid response elements that control expression of the retinoic acid receptor beta 2 and alcohol dehydrogenase 3 genes. Transactivates both the phenobarbital responsive element module of the human CYP2B6 gene and the CYP3A4 xenobiotic response element. Interacts with ECT2. Heterodimer of NR1I3 and RXR. Interacts with PSMC4. Directly interacts with DNAJC7. The DNAJC7-NR1I3 complex may also include HSP90. By dexamethasone. Predominantly expressed in liver. Belongs to the nuclear hormone receptor family. NR1 subfamily. 7 isoforms of the human protein are produced by alternative splicing.

Protein type: Nuclear receptor; DNA-binding

Chromosomal Location of Human Ortholog: 1q23.3

Cellular Component: cytoplasm; nucleoplasm; nucleus

Molecular Function: androgen receptor activity; DNA binding; ligand-dependent nuclear receptor activity; transcription coactivator activity; transcription factor activity

Biological Process: positive regulation of transcription from RNA polymerase II promoter; signal transduction; transcription initiation from RNA polymerase II promoter

Research Articles on NR1I3

Similar Products

Product Notes

The NR1I3 nr1i3 (Catalog #AAA1274232) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccagta gggaagatga gctgaggaac tgtgtggtat gtggggacca agccacaggc taccacttta atgcgctgac ttgtgagggc tgcaagggtt tcttcaggag aacagtcagc aaaagcattg gtcccacctg cccctttgct ggaagctgtg aagtcagcaa gactcagagg cgccactgcc cagcctgcag gttgcagaag tgcttagatg ctggcatgag gaaagacatg atactgtcgg cagaagccct ggcattgcgg cgagcaaagc aggcccagcg gcgggcacag caaacacctg tgcaactgag taaggagcaa gaagagctga tccggacact cctgggggcc cacacccgcc acatgggcac catgtttgaa cagtttgtgc agtttaggcc tccagctcat ctgttcatcc atcaccagcc cttgcccacc ctggcccctg tgctgcctct ggtcacacac ttcgcagaca tcaacacttt catggtactg caagtcatca agtttactaa ggacctgcct gtcttccgtt ccctgcccat tgaagaccag atctcccttc tcaagggagc agctgtggaa atctgtcaca tcgtactcaa taccactttc tgtctccaaa cacaaaactt cctctgcggg cctcttcgct acacaattga agatggagcc cgtgtatctc ccacagtggg gttccaggta gagtttttgg agttgctctt tcacttccat ggaacactac gaaaactgca gctccaagag cctgagtatg tgctcttggc tgccatggcc ctcttctctc ctgaccgacc tggagttacc cagagagatg agattgatca gctgcaagag gagatggcac tgactctgca aagctacatc aagggccagc agcgaaggcc ccgggatcgg tttctgtatg cgaagttgct aggcctgctg gctgagctcc ggagcattaa tgaggcctac gggtaccaaa tccagcacat ccagggcctg tctgccatga tgccgctgct ccaggagatc tgcagctga. It is sometimes possible for the material contained within the vial of "NR1I3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.