Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NPL cdna clone

NPL cDNA Clone

Gene Names
NPL; NAL; C112; NPL1; C1orf13
Synonyms
NPL; NPL cDNA Clone; NPL cdna clone
Ordering
For Research Use Only!
Sequence
atggccttcccaaagaagaaacttcagggtcttgtggctgcaaccatcacgccaatgactgagaatggagaaatcaacttttcagtaattggtcagtatgtggattatcttgtgaaagaacagggagtgaagaacatttttgtgaatggcacaacaggagaaggcctgtccctgagcgtctcagagcgtcgccaggttgcagaggagtgggtgacaaaagggaaggacaagctggatcaggtgataattcacgtaggagcactgagcttgaaggagtcacaggaactggcccaacatgcagcagaaataggagctgatggcatcgctgtcattgcaccgttcttcctcaagccatggaccaaagatatcctgattaatttcctaaaggaagtggctgctgccgcccctgccctgccattttattactatcacattcctgccttgacaggggtaaagattcgtgctgaggagttgttggatgggattctggataagatccccaccttccaagggctgaaattcagtgatacagatctcttagacttcgggcaatgtgttgatcagaatcgccagcaacagtttgctttcctttttggggtggatgagttttgtatccagagatttatcaactttgttgtcaaactagaaaactcaaaactcaaagtttcaaagaaccaaaggactcttcctctgggcaccacaaacttccccttcctccactga
Sequence Length
723
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,201 Da
NCBI Official Full Name
Homo sapiens N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase), mRNA
NCBI Official Synonym Full Names
N-acetylneuraminate pyruvate lyase
NCBI Official Symbol
NPL
NCBI Official Synonym Symbols
NAL; C112; NPL1; C1orf13
NCBI Protein Information
N-acetylneuraminate lyase
UniProt Protein Name
N-acetylneuraminate lyase
Protein Family
UniProt Gene Name
NPL
UniProt Synonym Gene Names
C1orf13; NALase
UniProt Entry Name
NPL_HUMAN

NCBI Description

This gene encodes a member of the N-acetylneuraminate lyase sub-family of (beta/alpha)(8)-barrel enzymes. N-acetylneuraminate lyases regulate cellular concentrations of N-acetyl-neuraminic acid (sialic acid) by mediating the reversible conversion of sialic acid into N-acetylmannosamine and pyruvate. A pseudogene of this gene is located on the short arm of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]

Uniprot Description

NPL: Catalyzes the cleavage of N-acetylneuraminic acid (sialic acid) to form pyruvate and N-acetylmannosamine via a Schiff base intermediate. It prevents sialic acids from being recycled and returning to the cell surface. Belongs to the DHDPS family. NanA subfamily. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 4.1.3.3; Carbohydrate Metabolism - amino sugar and nucleotide sugar; Lyase

Chromosomal Location of Human Ortholog: 1q25

Cellular Component: cytosol

Molecular Function: N-acetylneuraminate lyase activity; protein binding

Biological Process: N-acetylneuraminate catabolic process

Research Articles on NPL

Similar Products

Product Notes

The NPL npl (Catalog #AAA1266228) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccttcc caaagaagaa acttcagggt cttgtggctg caaccatcac gccaatgact gagaatggag aaatcaactt ttcagtaatt ggtcagtatg tggattatct tgtgaaagaa cagggagtga agaacatttt tgtgaatggc acaacaggag aaggcctgtc cctgagcgtc tcagagcgtc gccaggttgc agaggagtgg gtgacaaaag ggaaggacaa gctggatcag gtgataattc acgtaggagc actgagcttg aaggagtcac aggaactggc ccaacatgca gcagaaatag gagctgatgg catcgctgtc attgcaccgt tcttcctcaa gccatggacc aaagatatcc tgattaattt cctaaaggaa gtggctgctg ccgcccctgc cctgccattt tattactatc acattcctgc cttgacaggg gtaaagattc gtgctgagga gttgttggat gggattctgg ataagatccc caccttccaa gggctgaaat tcagtgatac agatctctta gacttcgggc aatgtgttga tcagaatcgc cagcaacagt ttgctttcct ttttggggtg gatgagtttt gtatccagag atttatcaac tttgttgtca aactagaaaa ctcaaaactc aaagtttcaa agaaccaaag gactcttcct ctgggcacca caaacttccc cttcctccac tga. It is sometimes possible for the material contained within the vial of "NPL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.