Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NMI cdna clone

NMI cDNA Clone

Synonyms
NMI; NMI cDNA Clone; NMI cdna clone
Ordering
For Research Use Only!
Sequence
atggaagctgataaagatgacacacaacaaattcttaaggagcattcgccagatgaatttataaaagatgaacaaaataagggactaattgatgaaattacaaagaaaaatattcagctaaggaaggagatccaaaagcttgaaacggagttacaagaggctaccaaagaattccagattaaagaggatattcctgaaacaaagatgaaattcttatcagttgaaactcctgagaatgacagccagttgtcaaatatctcctgttcgtttcaagtgagctcgaaagttccttatgagatacaaaaaggacaagcacttatcacctttgaaaaagaagaagttgctcaaaatgtggtaagcatgagtaaacatcatgtacagataaaagatgtaaatctggaggttacggccaagccagttccattaaattcaggagtcagattccaggtttatgtagaagtttctaaaatgaaaatcaatgttactgaaattcctgacacactgcgtgaagatcaaatgagagacaaactagagctgagcttttcaaagtcccgaaatggaggcggagaggtggaccgcgtggactatgacagacagtccgggagtgcagtcatcacgtttgtggagattggagtggctgacaagattttgaaaaagaaagaataccctctttatataaatcaaacttgccatagagttactgtttctccatacacagaaatacacttgaaaaagtatcagatattttcaggaacatctaagaggacagtgcttctgacaggaatggaaggcattcaaatggatgaagaaattgtggaggatttaattaacattcactttcaacgggcaaagaatggaggtggagaagtagatgtggtcaagtgttctctaggtcaacctcacatagcatactttgaagaatag
Sequence Length
924
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,057 Da
NCBI Official Full Name
Homo sapiens N-myc (and STAT) interactor, mRNA
NCBI Official Synonym Full Names
N-myc and STAT interactor
NCBI Official Symbol
NMI
NCBI Protein Information
N-myc-interactor
UniProt Protein Name
N-myc-interactor
Protein Family
UniProt Gene Name
NMI
UniProt Synonym Gene Names
Nmi
UniProt Entry Name
NMI_HUMAN

NCBI Description

NMYC interactor (NMI) encodes a protein that interacts with NMYC and CMYC (two members of the oncogene Myc family), and other transcription factors containing a Zip, HLH, or HLH-Zip motif. The NMI protein also interacts with all STATs except STAT2 and augments STAT-mediated transcription in response to cytokines IL2 and IFN-gamma. The NMI mRNA has low expression levels in all human fetal and adult tissues tested except brain and has high expression in cancer cell line-myeloid leukemias. [provided by RefSeq, Jul 2008]

Uniprot Description

NMI: May be involved in augmenting coactivator protein recruitment to a group of sequence-specific transcription factors. Augments cytokine-mediated STAT transcription. Enhances CBP/p300 coactivator protein recruitment to STAT1 and STAT5. Belongs to the NMI family.

Protein type: Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 2q23

Cellular Component: cytoplasm; nucleoplasm

Molecular Function: protein binding

Biological Process: inflammatory response; JAK-STAT cascade

Research Articles on NMI

Similar Products

Product Notes

The NMI nmi (Catalog #AAA1266097) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagctg ataaagatga cacacaacaa attcttaagg agcattcgcc agatgaattt ataaaagatg aacaaaataa gggactaatt gatgaaatta caaagaaaaa tattcagcta aggaaggaga tccaaaagct tgaaacggag ttacaagagg ctaccaaaga attccagatt aaagaggata ttcctgaaac aaagatgaaa ttcttatcag ttgaaactcc tgagaatgac agccagttgt caaatatctc ctgttcgttt caagtgagct cgaaagttcc ttatgagata caaaaaggac aagcacttat cacctttgaa aaagaagaag ttgctcaaaa tgtggtaagc atgagtaaac atcatgtaca gataaaagat gtaaatctgg aggttacggc caagccagtt ccattaaatt caggagtcag attccaggtt tatgtagaag tttctaaaat gaaaatcaat gttactgaaa ttcctgacac actgcgtgaa gatcaaatga gagacaaact agagctgagc ttttcaaagt cccgaaatgg aggcggagag gtggaccgcg tggactatga cagacagtcc gggagtgcag tcatcacgtt tgtggagatt ggagtggctg acaagatttt gaaaaagaaa gaataccctc tttatataaa tcaaacttgc catagagtta ctgtttctcc atacacagaa atacacttga aaaagtatca gatattttca ggaacatcta agaggacagt gcttctgaca ggaatggaag gcattcaaat ggatgaagaa attgtggagg atttaattaa cattcacttt caacgggcaa agaatggagg tggagaagta gatgtggtca agtgttctct aggtcaacct cacatagcat actttgaaga atag. It is sometimes possible for the material contained within the vial of "NMI, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.