NAT14 cdna clone
NAT14 cDNA Clone
Gene Names
NAT14; KLP1
Synonyms
NAT14; NAT14 cDNA Clone; NAT14 cdna clone
Sequence
atggcccccagccacctgtcagtgcgggagatgagggaagatgagaagcccctggtgctggagatgctgaaggccggcgtgaaggacacggaaaaccgcgtggccctccatgccttgacacggccgccggccctgctcctcctggcggcggccagcagcggcctgcgctttgtcctggcttccttcgccctggccctcctcctgccggtgttcctggctgtggccgccgtgaagctgggcctgcgggcccgatggggctcgctgcctccgccgggtggcctggggggcccctgggtggccgtgcggggctccggtgacgtgtgtggggtcctggctctggcccctggcacaaatgcaggggacggggcccgggtcacccgcctgtctgtctctcgctggcaccgccgccggggcgtgggcaggaggctgctggccttcgcggaggcccgggctcgggcctgggctgggggcatgggggagccccgggcccggctcgtggtccccgtggctgtggccgcctggggggtgggagggatgctggagggctgtggctaccaggccgaggggggctggggctgcctgggctacacgctggtgagggaattcagcaaagacctgtga
Sequence Length
621
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
21,650 Da
NCBI Official Full Name
Homo sapiens N-acetyltransferase 14 (GCN5-related, putative), mRNA
NCBI Official Synonym Full Names
N-acetyltransferase 14 (putative)
NCBI Official Symbol
NAT14
NCBI Official Synonym Symbols
KLP1
NCBI Protein Information
N-acetyltransferase 14
UniProt Protein Name
N-acetyltransferase 14
Protein Family
UniProt Gene Name
NAT14
UniProt Synonym Gene Names
KLP1
UniProt Entry Name
NAT14_HUMAN
Uniprot Description
NAT14: Probable acetyltransferase that binds the 5'-GGACTACAG- 3' sequence of coproporphyrinogen oxidase promoter. Able to activate transcription of a reporter construct in vitro. Belongs to the camello family.
Protein type: Acetyltransferase; Membrane protein, integral; EC 2.3.1.-
Chromosomal Location of Human Ortholog: 19q13.42
Research Articles on NAT14
Similar Products
Product Notes
The NAT14 nat14 (Catalog #AAA1268519) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccccca gccacctgtc agtgcgggag atgagggaag atgagaagcc cctggtgctg gagatgctga aggccggcgt gaaggacacg gaaaaccgcg tggccctcca tgccttgaca cggccgccgg ccctgctcct cctggcggcg gccagcagcg gcctgcgctt tgtcctggct tccttcgccc tggccctcct cctgccggtg ttcctggctg tggccgccgt gaagctgggc ctgcgggccc gatggggctc gctgcctccg ccgggtggcc tggggggccc ctgggtggcc gtgcggggct ccggtgacgt gtgtggggtc ctggctctgg cccctggcac aaatgcaggg gacggggccc gggtcacccg cctgtctgtc tctcgctggc accgccgccg gggcgtgggc aggaggctgc tggccttcgc ggaggcccgg gctcgggcct gggctggggg catgggggag ccccgggccc ggctcgtggt ccccgtggct gtggccgcct ggggggtggg agggatgctg gagggctgtg gctaccaggc cgaggggggc tggggctgcc tgggctacac gctggtgagg gaattcagca aagacctgtg a. It is sometimes possible for the material contained within the vial of "NAT14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
