NARG2 cdna clone
NARG2 cDNA Clone
Gene Names
ICE2; BRCC1; NARG2
Synonyms
NARG2; NARG2 cDNA Clone; NARG2 cdna clone
Sequence
atgcaggatgagctcttaaagccaatttccagaaaagtaccagaattgcccttaatgaatttagaaaattctaaacagccttctgtttctgagcaattgtctggtccttcagactcctctagttggccgaaatctggatggccttctgcatttcagaagccaaaaggacgattgccatatgaacttcaggactatgttgaagatacatcggaatacctagctcctcaggaaggaaattttgtttataagttatttagcctgcaagacctgttgttactcgtacgctgcagtgtccagaggatagagacaagaccacgttctaaaaaacggaagaaaatcagaagacaatttccagtttatgtactaccaaaagtagagtatcaagcttgttacggagttgaagctctgactgaaagtgaactttgtcgcttatggactgaaagtttattgcattccaacagctcattttatgttgggcatatcgatgcatttacttcaaaactttttctactggaagaaattacctcagaagaattaaaagaaaagctttcagcactcaagatttccaatttatttaacatcctccaacacattctaaagaaactaagtagcttgcaggagggttcctacttgttatctcatgcagcagaagattcttcactcctgatttataaggcctctgatggaaaagttactaggacagcatacaatttgtataaaacacattgcggccttcctggtgtaccttccagtctctcagttccctgggtcccattagatcccagcctgttattaccatatcatatccatcatggaagaataccttgtacttttccaccgaaatcactggataccacaacacaacaaaagattggtggaacgagaatgcctacacgcagccacaggaatccagtttccatggaaaccaaaagcagttgcttgcctgctcagcaagttgaaactgaaggagtggctccacataaaagaaaaataacttga
Sequence Length
999
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
8,572 Da
NCBI Official Full Name
Homo sapiens NMDA receptor regulated 2, mRNA
NCBI Official Synonym Full Names
interactor of little elongation complex ELL subunit 2
NCBI Official Symbol
ICE2
NCBI Official Synonym Symbols
BRCC1; NARG2
NCBI Protein Information
little elongation complex subunit 2
UniProt Protein Name
Little elongation complex subunit 2
UniProt Gene Name
ICE2
UniProt Synonym Gene Names
BRCC1; NARG2
UniProt Entry Name
ICE2_HUMAN
Uniprot Description
NARG2: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 15q22.2
Cellular Component: Cajal body; nucleoplasm; transcription elongation factor complex
Molecular Function: protein binding
Biological Process: positive regulation of transcription from RNA polymerase III promoter; snRNA transcription from RNA polymerase II promoter; snRNA transcription from RNA polymerase III promoter
Similar Products
Product Notes
The NARG2 ice2 (Catalog #AAA1272172) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggatg agctcttaaa gccaatttcc agaaaagtac cagaattgcc cttaatgaat ttagaaaatt ctaaacagcc ttctgtttct gagcaattgt ctggtccttc agactcctct agttggccga aatctggatg gccttctgca tttcagaagc caaaaggacg attgccatat gaacttcagg actatgttga agatacatcg gaatacctag ctcctcagga aggaaatttt gtttataagt tatttagcct gcaagacctg ttgttactcg tacgctgcag tgtccagagg atagagacaa gaccacgttc taaaaaacgg aagaaaatca gaagacaatt tccagtttat gtactaccaa aagtagagta tcaagcttgt tacggagttg aagctctgac tgaaagtgaa ctttgtcgct tatggactga aagtttattg cattccaaca gctcatttta tgttgggcat atcgatgcat ttacttcaaa actttttcta ctggaagaaa ttacctcaga agaattaaaa gaaaagcttt cagcactcaa gatttccaat ttatttaaca tcctccaaca cattctaaag aaactaagta gcttgcagga gggttcctac ttgttatctc atgcagcaga agattcttca ctcctgattt ataaggcctc tgatggaaaa gttactagga cagcatacaa tttgtataaa acacattgcg gccttcctgg tgtaccttcc agtctctcag ttccctgggt cccattagat cccagcctgt tattaccata tcatatccat catggaagaa taccttgtac ttttccaccg aaatcactgg ataccacaac acaacaaaag attggtggaa cgagaatgcc tacacgcagc cacaggaatc cagtttccat ggaaaccaaa agcagttgct tgcctgctca gcaagttgaa actgaaggag tggctccaca taaaagaaaa ataacttga. It is sometimes possible for the material contained within the vial of "NARG2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
