Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NAPSA cdna clone

NAPSA cDNA Clone

Gene Names
NAPSA; KAP; Kdap; NAP1; NAPA; SNAPA
Synonyms
NAPSA; NAPSA cDNA Clone; NAPSA cdna clone
Ordering
For Research Use Only!
Sequence
atgtctccaccaccgctgctgcaacccctgctgctgctgctgcctctgctgaatgtggagccttccggggccacactgatccgcatccctcttcatcgagtccaacctggacgcaggaccctgaacctactgaggggatggagagaaccagcagagctccccaagttgggggccccatcccctggggacaagcccatcttcgtacctctctcgaactacagggatgtgcagtattttggggaaattgggctgggaacgcctccacaaaacttcactgttgcctttgacactggctcctccaatctctgggtcccgtccaggagatgccacttcttcagtgtgccctgctggttacaccaccgatttgatcccaaagcctctagctccttccaggccaatgggaccaagtttgccattcaatatggaactgggcgggtagatggaatcctgagcgaggacaagctgactattggtggaatcaagggtgcatcagtgattttcggggaggctctctgggagcccagcctggtcttcgcttttgcccattttgatgggatattgggcctcggttttcccattctgtctgtggaaggagttcggcccccgatggatgtactggtggagcaggggctattggataagcctgtcttctccttttacctcaacagggaccctgaagagcctgatggaggagagctggtcctggggggctcggacccggcacactacatcccacccctcaccttcgtgccagtcacggtccccgcctactggcagatccacatggagcgtgtgaaggtgggcccagggctgactctctgtgccaagggctgtgctgccatcctggatacgggcacgtccctcatcacaggacccactgaggagatccgggccctgcatgcagccattgggggaatccccttgctggctggggagtacatcatcctgtgctcggaaatcccaaagctccccgcagtctccttccttcttgggggggtctggtttaacctcacggcccatgattacgtcatccagactactcgaaatggcgtccgcctctgcttgtccggtttccaggccctggatgtccctccgcctgcagggcccttctggatcctcggtgacgtcttcttggggacgtatgtggccgtcttcgaccgcggggacatgaagagcagcgcccgggtgggcctggcgcgcgctcgcactcgcggagcggacctcggatggggagagactgcgcaggcgcagttccccgggtga
Sequence Length
1263
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,387 Da
NCBI Official Full Name
Homo sapiens napsin A aspartic peptidase, mRNA
NCBI Official Synonym Full Names
napsin A aspartic peptidase
NCBI Official Symbol
NAPSA
NCBI Official Synonym Symbols
KAP; Kdap; NAP1; NAPA; SNAPA
NCBI Protein Information
napsin-A
UniProt Protein Name
Napsin-A
Protein Family
UniProt Gene Name
NAPSA
UniProt Synonym Gene Names
NAP1; NAPA; ASP4; Asp 4
UniProt Entry Name
NAPSA_HUMAN

NCBI Description

This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein is proteolytically processed to generate an activation peptide and the mature protease. The activation peptides of aspartic proteinases function as inhibitors of the protease active site. These peptide segments, or pro-parts, are deemed important for correct folding, targeting, and control of the activation of aspartic proteinase zymogens. The encoded protease may play a role in the proteolytic processing of pulmonary surfactant protein B in the lung and may function in protein catabolism in the renal proximal tubules. This gene has been described as a marker for lung adenocarcinoma and renal cell carcinoma. [provided by RefSeq, Feb 2016]

Uniprot Description

NAPSA: May be involved in processing of pneumocyte surfactant precursors. Belongs to the peptidase A1 family.

Protein type: EC 3.4.23.-; Secreted, signal peptide; Protease; Secreted

Chromosomal Location of Human Ortholog: 19q13.33

Cellular Component: extracellular space; lysosome

Molecular Function: aspartic-type endopeptidase activity; endopeptidase activity; peptidase activity

Biological Process: cellular protein metabolic process; membrane protein proteolysis; protein catabolic process; surfactant homeostasis

Research Articles on NAPSA

Similar Products

Product Notes

The NAPSA napsa (Catalog #AAA1268692) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctccac caccgctgct gcaacccctg ctgctgctgc tgcctctgct gaatgtggag ccttccgggg ccacactgat ccgcatccct cttcatcgag tccaacctgg acgcaggacc ctgaacctac tgaggggatg gagagaacca gcagagctcc ccaagttggg ggccccatcc cctggggaca agcccatctt cgtacctctc tcgaactaca gggatgtgca gtattttggg gaaattgggc tgggaacgcc tccacaaaac ttcactgttg cctttgacac tggctcctcc aatctctggg tcccgtccag gagatgccac ttcttcagtg tgccctgctg gttacaccac cgatttgatc ccaaagcctc tagctccttc caggccaatg ggaccaagtt tgccattcaa tatggaactg ggcgggtaga tggaatcctg agcgaggaca agctgactat tggtggaatc aagggtgcat cagtgatttt cggggaggct ctctgggagc ccagcctggt cttcgctttt gcccattttg atgggatatt gggcctcggt tttcccattc tgtctgtgga aggagttcgg cccccgatgg atgtactggt ggagcagggg ctattggata agcctgtctt ctccttttac ctcaacaggg accctgaaga gcctgatgga ggagagctgg tcctgggggg ctcggacccg gcacactaca tcccacccct caccttcgtg ccagtcacgg tccccgccta ctggcagatc cacatggagc gtgtgaaggt gggcccaggg ctgactctct gtgccaaggg ctgtgctgcc atcctggata cgggcacgtc cctcatcaca ggacccactg aggagatccg ggccctgcat gcagccattg ggggaatccc cttgctggct ggggagtaca tcatcctgtg ctcggaaatc ccaaagctcc ccgcagtctc cttccttctt gggggggtct ggtttaacct cacggcccat gattacgtca tccagactac tcgaaatggc gtccgcctct gcttgtccgg tttccaggcc ctggatgtcc ctccgcctgc agggcccttc tggatcctcg gtgacgtctt cttggggacg tatgtggccg tcttcgaccg cggggacatg aagagcagcg cccgggtggg cctggcgcgc gctcgcactc gcggagcgga cctcggatgg ggagagactg cgcaggcgca gttccccggg tga. It is sometimes possible for the material contained within the vial of "NAPSA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.