NANP cdna clone
NANP cDNA Clone
Gene Names
NANP; HDHD4; C20orf147; dJ694B14.3
Synonyms
NANP; NANP cDNA Clone; NANP cdna clone
Sequence
atggggctgagccgcgtgcgggcggttttctttgacttggacaacactctcatcgacacggccggggcgagcaggagaggcatgttggaggtgataaaactcttacaatcaaaataccattataaagaagaggctgaaatcatctgtgataaagttcaagttaaactcagcaaggaatgttttcatccttacaatacatgcattactgatttaaggacttcacattgggaagaagcaatccaggaaacaaaaggtggtgcagccaatagaaaattggctgaagaatgttatttcctttggaaatctacacgtttacagcatatgacactagcagaagacgtcaaagccatgcttactgaacttcgaaaggaggtccgcctacttctattaacgaatggggacagacagacccagagggagaagattgaggcttgtgcctgtcagtcctattttgacgctgttgttgtaggtggagagcagagagaggagaaaccagcaccgtccatattttattactgctgcaatcttctcggagtacaacctggggactgtgtgatggtcggtgacacattagaaaccgacatccaaggaggcctcaatgcaggattgaaagcaacagtctggatcaataaaaatggaatagtgccactgaagtcctccccagttccgcattacatggtttcttctgtgctagagttacctgctctcttacaaagtatagactgcaaagtcagtatgtccacttaa
Sequence Length
747
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
27,813 Da
NCBI Official Full Name
Homo sapiens N-acetylneuraminic acid phosphatase, mRNA
NCBI Official Synonym Full Names
N-acetylneuraminic acid phosphatase
NCBI Official Symbol
NANP
NCBI Official Synonym Symbols
HDHD4; C20orf147; dJ694B14.3
NCBI Protein Information
N-acylneuraminate-9-phosphatase
UniProt Protein Name
N-acylneuraminate-9-phosphatase
Protein Family
UniProt Gene Name
NANP
UniProt Synonym Gene Names
C20orf147; HDHD4
UniProt Entry Name
NANP_HUMAN
Uniprot Description
HDHD4: Belongs to the HAD-like hydrolase superfamily. NANP family.
Protein type: Phosphatase (non-protein); EC 3.1.3.29; Carbohydrate Metabolism - amino sugar and nucleotide sugar
Chromosomal Location of Human Ortholog: 20p11.1
Cellular Component: cytosol
Molecular Function: N-acylneuraminate-9-phosphatase activity
Biological Process: N-acetylneuraminate biosynthetic process
Similar Products
Product Notes
The NANP nanp (Catalog #AAA1267820) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggctga gccgcgtgcg ggcggttttc tttgacttgg acaacactct catcgacacg gccggggcga gcaggagagg catgttggag gtgataaaac tcttacaatc aaaataccat tataaagaag aggctgaaat catctgtgat aaagttcaag ttaaactcag caaggaatgt tttcatcctt acaatacatg cattactgat ttaaggactt cacattggga agaagcaatc caggaaacaa aaggtggtgc agccaataga aaattggctg aagaatgtta tttcctttgg aaatctacac gtttacagca tatgacacta gcagaagacg tcaaagccat gcttactgaa cttcgaaagg aggtccgcct acttctatta acgaatgggg acagacagac ccagagggag aagattgagg cttgtgcctg tcagtcctat tttgacgctg ttgttgtagg tggagagcag agagaggaga aaccagcacc gtccatattt tattactgct gcaatcttct cggagtacaa cctggggact gtgtgatggt cggtgacaca ttagaaaccg acatccaagg aggcctcaat gcaggattga aagcaacagt ctggatcaat aaaaatggaa tagtgccact gaagtcctcc ccagttccgc attacatggt ttcttctgtg ctagagttac ctgctctctt acaaagtata gactgcaaag tcagtatgtc cacttaa. It is sometimes possible for the material contained within the vial of "NANP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
